Incidental Mutation 'R3156:Sez6'
ID263506
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Nameseizure related gene 6
SynonymsD11Bhm177e, sez-6
MMRRC Submission 040607-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R3156 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77930800-77979048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77953779 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 143 (S143T)
Ref Sequence ENSEMBL: ENSMUSP00000091532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000646
AA Change: S143T

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: S143T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093995
AA Change: S143T

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: S143T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142542
Predicted Effect probably benign
Transcript: ENSMUST00000151982
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155087
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,160,042 I30F possibly damaging Het
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adra2b T C 2: 127,363,650 L29P probably damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Col4a2 T A 8: 11,313,414 probably benign Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Hps6 A G 19: 46,003,741 D39G probably damaging Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Paxbp1 T C 16: 91,035,990 T304A probably benign Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Setbp1 A G 18: 78,859,303 V383A probably benign Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77977289 splice site probably benign
IGL01142:Sez6 APN 11 77973816 missense probably damaging 1.00
IGL02252:Sez6 APN 11 77974513 missense probably damaging 1.00
IGL02332:Sez6 APN 11 77954742 splice site probably benign
IGL02366:Sez6 APN 11 77976882 missense probably damaging 0.98
IGL02479:Sez6 APN 11 77978026 missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77962949 missense possibly damaging 0.93
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0089:Sez6 UTSW 11 77974344 splice site probably benign
R0485:Sez6 UTSW 11 77953813 missense probably damaging 1.00
R0598:Sez6 UTSW 11 77977821 missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77976585 missense probably benign 0.01
R1117:Sez6 UTSW 11 77974514 missense probably damaging 1.00
R1199:Sez6 UTSW 11 77953885 missense probably benign
R1534:Sez6 UTSW 11 77963045 missense probably damaging 1.00
R1835:Sez6 UTSW 11 77953503 missense probably benign
R1840:Sez6 UTSW 11 77953717 missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77972932 missense probably damaging 1.00
R1970:Sez6 UTSW 11 77954068 critical splice donor site probably null
R3930:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R3931:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R4894:Sez6 UTSW 11 77975260 missense probably damaging 1.00
R4904:Sez6 UTSW 11 77975254 missense probably damaging 1.00
R5026:Sez6 UTSW 11 77968989 missense probably damaging 1.00
R5040:Sez6 UTSW 11 77969089 critical splice donor site probably null
R5057:Sez6 UTSW 11 77973153 missense probably damaging 1.00
R5093:Sez6 UTSW 11 77976562 missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77973759 intron probably benign
R6013:Sez6 UTSW 11 77973797 missense probably damaging 1.00
R6126:Sez6 UTSW 11 77973804 missense probably damaging 1.00
R6153:Sez6 UTSW 11 77977822 missense probably damaging 0.99
R6279:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77973844
R6722:Sez6 UTSW 11 77953702 missense probably damaging 1.00
R6897:Sez6 UTSW 11 77953559 missense probably damaging 1.00
R6910:Sez6 UTSW 11 77953869 missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77977795 missense probably benign 0.04
R7233:Sez6 UTSW 11 77973137 missense probably damaging 1.00
R7265:Sez6 UTSW 11 77962865 missense probably damaging 0.96
R7289:Sez6 UTSW 11 77974323 missense possibly damaging 0.96
R7405:Sez6 UTSW 11 77962891 missense probably benign 0.10
X0013:Sez6 UTSW 11 77954780 missense probably benign 0.01
X0067:Sez6 UTSW 11 77974438 critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77973197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCACCCACTTCTGGAAGAATTTC -3'
(R):5'- CCTGTGGTCTTAGACATGACCTC -3'

Sequencing Primer
(F):5'- TTTCTTCAAGAGGGGCTAGAAAG -3'
(R):5'- GGTCTTAGACATGACCTCTGGAAC -3'
Posted On2015-02-05