Incidental Mutation 'R3156:Paxbp1'
ID263519
Institutional Source Beutler Lab
Gene Symbol Paxbp1
Ensembl Gene ENSMUSG00000022974
Gene NamePAX3 and PAX7 binding protein 1
Synonyms
MMRRC Submission 040607-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R3156 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91014037-91044543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91035990 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 304 (T304A)
Ref Sequence ENSEMBL: ENSMUSP00000113835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118522]
Predicted Effect unknown
Transcript: ENSMUST00000023698
AA Change: T240A
SMART Domains Protein: ENSMUSP00000023698
Gene: ENSMUSG00000022974
AA Change: T240A

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 60 86 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 434 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118522
AA Change: T304A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113835
Gene: ENSMUSG00000022974
AA Change: T304A

DomainStartEndE-ValueType
coiled coil region 3 28 N/A INTRINSIC
low complexity region 114 120 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
Pfam:GCFC 597 812 5.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127002
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may bind to GC-rich DNA sequences, which suggests its involvement in the regulation of transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,160,042 I30F possibly damaging Het
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adra2b T C 2: 127,363,650 L29P probably damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Col4a2 T A 8: 11,313,414 probably benign Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Hps6 A G 19: 46,003,741 D39G probably damaging Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Setbp1 A G 18: 78,859,303 V383A probably benign Het
Sez6 T A 11: 77,953,779 S143T possibly damaging Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in Paxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Paxbp1 APN 16 91035916 splice site probably benign
IGL01705:Paxbp1 APN 16 91016988 missense probably benign 0.01
IGL02418:Paxbp1 APN 16 91034112 missense probably damaging 1.00
IGL02527:Paxbp1 APN 16 91037273 missense possibly damaging 0.57
IGL02661:Paxbp1 APN 16 91030525 missense probably benign 0.43
IGL02796:Paxbp1 APN 16 91025294 unclassified probably benign
IGL03336:Paxbp1 APN 16 91034172 missense probably benign
R0016:Paxbp1 UTSW 16 91036036 splice site probably benign
R0306:Paxbp1 UTSW 16 91022115 missense possibly damaging 0.54
R0331:Paxbp1 UTSW 16 91037367 missense possibly damaging 0.95
R0724:Paxbp1 UTSW 16 91036536 missense probably damaging 1.00
R0944:Paxbp1 UTSW 16 91023427 missense probably benign 0.25
R1348:Paxbp1 UTSW 16 91035016 missense probably damaging 0.97
R1909:Paxbp1 UTSW 16 91044305 unclassified probably benign
R2234:Paxbp1 UTSW 16 91034934 missense probably benign 0.05
R3819:Paxbp1 UTSW 16 91022752 unclassified probably benign
R3910:Paxbp1 UTSW 16 91042681 missense probably damaging 1.00
R3949:Paxbp1 UTSW 16 91044017 missense probably damaging 1.00
R4109:Paxbp1 UTSW 16 91016898 missense probably benign 0.10
R4577:Paxbp1 UTSW 16 91015154 missense probably damaging 1.00
R4584:Paxbp1 UTSW 16 91034123 missense probably damaging 1.00
R4596:Paxbp1 UTSW 16 91030547 missense probably benign 0.28
R4837:Paxbp1 UTSW 16 91034978 nonsense probably null
R4877:Paxbp1 UTSW 16 91044311 unclassified probably benign
R5079:Paxbp1 UTSW 16 91025146 critical splice donor site probably null
R5086:Paxbp1 UTSW 16 91015216 unclassified probably benign
R5167:Paxbp1 UTSW 16 91022667 critical splice donor site probably null
R5291:Paxbp1 UTSW 16 91044352 start codon destroyed probably null
R5322:Paxbp1 UTSW 16 91015162 missense probably benign 0.01
R5529:Paxbp1 UTSW 16 91030513 missense possibly damaging 0.62
R5662:Paxbp1 UTSW 16 91037397 missense probably benign 0.45
R5814:Paxbp1 UTSW 16 91030496 missense probably damaging 1.00
R6422:Paxbp1 UTSW 16 91023444 missense probably benign 0.07
R7225:Paxbp1 UTSW 16 91027068 missense probably damaging 1.00
X0026:Paxbp1 UTSW 16 91027242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCCTACCGACCTGATGAC -3'
(R):5'- TCATTAAAACAGGCCAAGTCAGG -3'

Sequencing Primer
(F):5'- TGCCAATTCACCCGTGACAG -3'
(R):5'- GCCAAGTCAGGAGGATCTAC -3'
Posted On2015-02-05