Incidental Mutation 'R0324:Hmgxb4'
ID26358
Institutional Source Beutler Lab
Gene Symbol Hmgxb4
Ensembl Gene ENSMUSG00000034518
Gene NameHMG box domain containing 4
SynonymsHmgb2l1, 4733401K04Rik
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R0324 (G1)
Quality Score211
Status Not validated
Chromosome8
Chromosomal Location74993356-75031978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74998928 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 7 (M7I)
Ref Sequence ENSEMBL: ENSMUSP00000133586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041759] [ENSMUST00000145919] [ENSMUST00000211863]
Predicted Effect probably benign
Transcript: ENSMUST00000041759
AA Change: M7I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045126
Gene: ENSMUSG00000034518
AA Change: M7I

DomainStartEndE-ValueType
low complexity region 53 63 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
Pfam:DUF4171 107 232 1.3e-55 PFAM
low complexity region 250 261 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
HMG 399 469 7.63e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134126
Predicted Effect probably benign
Transcript: ENSMUST00000145919
AA Change: M7I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133586
Gene: ENSMUSG00000034518
AA Change: M7I

DomainStartEndE-ValueType
low complexity region 53 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151062
Predicted Effect probably benign
Transcript: ENSMUST00000211863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212372
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] High mobility group (HMG) proteins are nonhistone chromosomal proteins. See HMG2 (MIM 163906) for additional information on HMG proteins.[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Hmgxb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Hmgxb4 APN 8 75029503 missense probably damaging 1.00
IGL00515:Hmgxb4 APN 8 75000911 missense probably damaging 1.00
IGL02337:Hmgxb4 APN 8 74999631 missense probably damaging 1.00
IGL03281:Hmgxb4 APN 8 75024162 missense probably damaging 1.00
R0749:Hmgxb4 UTSW 8 75000937 missense probably damaging 1.00
R5862:Hmgxb4 UTSW 8 75001055 missense probably damaging 1.00
R5910:Hmgxb4 UTSW 8 74999565 missense probably benign 0.21
R6190:Hmgxb4 UTSW 8 75023299 missense probably benign 0.00
R6307:Hmgxb4 UTSW 8 75023299 missense possibly damaging 0.51
R7031:Hmgxb4 UTSW 8 75029572 nonsense probably null
R7171:Hmgxb4 UTSW 8 75020262 missense probably damaging 1.00
R7197:Hmgxb4 UTSW 8 75029996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACAAGACACTCCTGTGTTCC -3'
(R):5'- TGTAAGATTCCCAGTCCCAGACTCC -3'

Sequencing Primer
(F):5'- AGTCAGCCCTTGGATTGC -3'
(R):5'- CTGGAGCTGGCAAGGACTAC -3'
Posted On2013-04-16