Incidental Mutation 'R3107:Mov10'
ID263611
Institutional Source Beutler Lab
Gene Symbol Mov10
Ensembl Gene ENSMUSG00000002227
Gene NameMoloney leukemia virus 10
SynonymsMov-10
MMRRC Submission 040581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R3107 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location104794836-104818563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104799724 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 653 (E653G)
Ref Sequence ENSEMBL: ENSMUSP00000128246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002297] [ENSMUST00000106774] [ENSMUST00000106775] [ENSMUST00000136148] [ENSMUST00000166979] [ENSMUST00000168015]
Predicted Effect probably damaging
Transcript: ENSMUST00000002297
AA Change: E653G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002297
Gene: ENSMUSG00000002227
AA Change: E653G

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106774
SMART Domains Protein: ENSMUSP00000102386
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106775
AA Change: E726G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102387
Gene: ENSMUSG00000002227
AA Change: E726G

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136148
Predicted Effect probably damaging
Transcript: ENSMUST00000166979
AA Change: E726G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126897
Gene: ENSMUSG00000002227
AA Change: E726G

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
AAA 590 772 5.72e-3 SMART
low complexity region 1026 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168015
AA Change: E653G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128246
Gene: ENSMUSG00000002227
AA Change: E653G

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196161
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout is embryonic lethal. Heterozygous knockout leads to reduced dendritic branching of neurons, which affects anxiety- and/or activity-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Ankrd26 A T 6: 118,556,243 F198L probably benign Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cers1 T A 8: 70,322,636 H233Q probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Ddt C T 10: 75,772,763 E42K probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Gprasp1 A T X: 135,799,759 M234L probably benign Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Olfr916 C T 9: 38,658,011 C127Y possibly damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sorcs1 T C 19: 50,210,650 E825G possibly damaging Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Mov10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Mov10 APN 3 104800947 splice site probably benign
IGL01111:Mov10 APN 3 104801405 missense possibly damaging 0.71
IGL01315:Mov10 APN 3 104795945 missense probably damaging 0.98
IGL01463:Mov10 APN 3 104800324 missense probably damaging 1.00
IGL02114:Mov10 APN 3 104795318 unclassified probably benign
IGL02354:Mov10 APN 3 104804121 splice site probably benign
IGL02361:Mov10 APN 3 104804121 splice site probably benign
IGL02692:Mov10 APN 3 104800803 nonsense probably null
IGL03104:Mov10 APN 3 104797307 missense probably damaging 1.00
IGL03121:Mov10 APN 3 104801002 missense probably benign
P0040:Mov10 UTSW 3 104804679 missense probably damaging 1.00
R0025:Mov10 UTSW 3 104804603 missense probably damaging 1.00
R0270:Mov10 UTSW 3 104795405 missense probably benign 0.09
R0747:Mov10 UTSW 3 104802496 missense probably benign 0.41
R1434:Mov10 UTSW 3 104795174 missense probably damaging 1.00
R1482:Mov10 UTSW 3 104804546 missense probably damaging 0.98
R1594:Mov10 UTSW 3 104795411 missense probably damaging 1.00
R1656:Mov10 UTSW 3 104799596 missense probably benign 0.03
R1739:Mov10 UTSW 3 104800282 missense probably damaging 0.98
R1785:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1786:Mov10 UTSW 3 104818116 missense possibly damaging 0.73
R1911:Mov10 UTSW 3 104801560 splice site probably benign
R1962:Mov10 UTSW 3 104796977 missense probably damaging 1.00
R1993:Mov10 UTSW 3 104799419 missense probably damaging 1.00
R2095:Mov10 UTSW 3 104801531 missense probably damaging 1.00
R2138:Mov10 UTSW 3 104804242 missense probably benign 0.00
R4241:Mov10 UTSW 3 104797276 missense probably benign 0.45
R4280:Mov10 UTSW 3 104799779 missense probably damaging 0.98
R4474:Mov10 UTSW 3 104818465 missense probably damaging 1.00
R5227:Mov10 UTSW 3 104802578 missense probably benign
R5391:Mov10 UTSW 3 104802533 missense probably benign 0.12
R5704:Mov10 UTSW 3 104799596 missense probably benign 0.03
R5819:Mov10 UTSW 3 104801512 missense probably damaging 1.00
R5842:Mov10 UTSW 3 104799379 splice site probably benign
R6059:Mov10 UTSW 3 104817950 utr 3 prime probably benign
R6692:Mov10 UTSW 3 104818044 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTCCATGCTTCAGGGCTAG -3'
(R):5'- CTGCCAGCAGGTACATATAGG -3'

Sequencing Primer
(F):5'- CTTCAGGGCTAGTGGCGAG -3'
(R):5'- CCAGCAGGTACATATAGGGTTTG -3'
Posted On2015-02-05