Incidental Mutation 'R3107:Cers1'
ID263621
Institutional Source Beutler Lab
Gene Symbol Cers1
Ensembl Gene ENSMUSG00000087408
Gene Nameceramide synthase 1
SynonymsCerS1, to, Uog-1, Lass1
MMRRC Submission 040581-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R3107 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70315775-70331592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70322636 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 233 (H233Q)
Ref Sequence ENSEMBL: ENSMUSP00000120598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140239] [ENSMUST00000165819]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136257
Predicted Effect probably benign
Transcript: ENSMUST00000140239
AA Change: H233Q

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408
AA Change: H233Q

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Mice lacking a functional copy of this gene exhibit impaired cerebellar development, locomotion and motor coordination. This protein is transcribed from a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for the spontaneous toppler mutation display reduced body and brain weight, a small cerebellum, progressive tremors, ataxia, impaired balance and seizures, as well as dramatic dendritic changes and severe loss of Purkinje cells, glial changes, and a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Ankrd26 A T 6: 118,556,243 F198L probably benign Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Ddt C T 10: 75,772,763 E42K probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Gprasp1 A T X: 135,799,759 M234L probably benign Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Mov10 T C 3: 104,799,724 E653G probably damaging Het
Olfr916 C T 9: 38,658,011 C127Y possibly damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sorcs1 T C 19: 50,210,650 E825G possibly damaging Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Cers1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Cers1 APN 8 70323233 missense probably damaging 1.00
IGL01982:Cers1 APN 8 70323431 missense probably damaging 0.99
IGL02827:Cers1 APN 8 70321527 missense probably damaging 1.00
R1025:Cers1 UTSW 8 70321536 missense probably benign 0.44
R1456:Cers1 UTSW 8 70331188 missense probably damaging 1.00
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1764:Cers1 UTSW 8 70321491 splice site probably null
R2397:Cers1 UTSW 8 70321536 missense probably benign 0.44
R3808:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R3809:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R4789:Cers1 UTSW 8 70323368 missense probably damaging 0.96
R5450:Cers1 UTSW 8 70318297 missense probably damaging 0.99
R5987:Cers1 UTSW 8 70321578 missense possibly damaging 0.78
R6274:Cers1 UTSW 8 70331077 missense probably damaging 1.00
R6535:Cers1 UTSW 8 70330154 missense probably damaging 1.00
R7060:Cers1 UTSW 8 70315905 missense possibly damaging 0.86
R7152:Cers1 UTSW 8 70318251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGCCTAAGTTCCTAGCAC -3'
(R):5'- ATGCCTTTACCCCTAATAAGCC -3'

Sequencing Primer
(F):5'- ACGGTGTTCCAGGAATCTGACAC -3'
(R):5'- TTACCCCTAATAAGCCCTTGC -3'
Posted On2015-02-05