Incidental Mutation 'R3107:Ddt'
ID263629
Institutional Source Beutler Lab
Gene Symbol Ddt
Ensembl Gene ENSMUSG00000001666
Gene NameD-dopachrome tautomerase
Synonyms
MMRRC Submission 040581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R3107 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75771230-75773414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75772763 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 42 (E42K)
Ref Sequence ENSEMBL: ENSMUSP00000134561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001715] [ENSMUST00000001716] [ENSMUST00000172820] [ENSMUST00000173537] [ENSMUST00000174187]
Predicted Effect probably benign
Transcript: ENSMUST00000001715
SMART Domains Protein: ENSMUSP00000001715
Gene: ENSMUSG00000001665

DomainStartEndE-ValueType
Pfam:GST_N 1 76 2.2e-13 PFAM
Pfam:GST_N_3 5 82 2.4e-13 PFAM
Pfam:GST_N_2 11 77 6.2e-10 PFAM
Pfam:GST_C 111 201 5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001716
AA Change: E87K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001716
Gene: ENSMUSG00000001666
AA Change: E87K

DomainStartEndE-ValueType
Pfam:MIF 2 116 8.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133869
SMART Domains Protein: ENSMUSP00000134134
Gene: ENSMUSG00000001665

DomainStartEndE-ValueType
PDB:2C3T|D 2 100 3e-52 PDB
SCOP:d1ljra1 6 107 4e-14 SMART
low complexity region 118 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172820
AA Change: E42K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134561
Gene: ENSMUSG00000001666
AA Change: E42K

DomainStartEndE-ValueType
Pfam:MIF 1 71 3.3e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173512
AA Change: E225K
SMART Domains Protein: ENSMUSP00000134112
Gene: ENSMUSG00000092360
AA Change: E225K

DomainStartEndE-ValueType
Pfam:GST_N 2 75 3.2e-13 PFAM
Pfam:GST_N_3 4 81 2.6e-13 PFAM
Pfam:GST_N_2 10 76 6.7e-10 PFAM
Pfam:MIF 159 252 8.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173537
SMART Domains Protein: ENSMUSP00000133498
Gene: ENSMUSG00000001665

DomainStartEndE-ValueType
Pfam:GST_N 3 76 5e-12 PFAM
Pfam:GST_N_3 5 82 1.2e-13 PFAM
Pfam:GST_N_2 11 77 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174187
SMART Domains Protein: ENSMUSP00000133576
Gene: ENSMUSG00000001665

DomainStartEndE-ValueType
PDB:2C3T|D 1 38 7e-16 PDB
SCOP:d1ljra2 1 38 6e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174649
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] D-dopachrome tautomerase converts D-dopachrome into 5,6-dihydroxyindole. The DDT gene is related to the migration inhibitory factor (MIF) in terms of sequence, enzyme activity, and gene structure. DDT and MIF are closely linked on chromosome 22. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Ankrd26 A T 6: 118,556,243 F198L probably benign Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cers1 T A 8: 70,322,636 H233Q probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Gprasp1 A T X: 135,799,759 M234L probably benign Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Mov10 T C 3: 104,799,724 E653G probably damaging Het
Olfr916 C T 9: 38,658,011 C127Y possibly damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sorcs1 T C 19: 50,210,650 E825G possibly damaging Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Ddt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0206:Ddt UTSW 10 75772885 start codon destroyed probably null 0.17
R0854:Ddt UTSW 10 75771495 missense probably benign 0.02
R1853:Ddt UTSW 10 75773304 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATTCCAGTGCCTGAGGAGTC -3'
(R):5'- TTAAGAATTTGGCGCGCCC -3'

Sequencing Primer
(F):5'- TGAGGAGTCCACCTTCGTG -3'
(R):5'- TGCCCAAGCTTCAGGATTTAAC -3'
Posted On2015-02-05