Incidental Mutation 'R3107:Dmrt2'
ID263645
Institutional Source Beutler Lab
Gene Symbol Dmrt2
Ensembl Gene ENSMUSG00000048138
Gene Namedoublesex and mab-3 related transcription factor 2
SynonymsTerra
MMRRC Submission 040581-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3107 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location25672420-25679010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25677691 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 218 (T218N)
Ref Sequence ENSEMBL: ENSMUSP00000059654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053068]
Predicted Effect probably benign
Transcript: ENSMUST00000053068
AA Change: T218N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000059654
Gene: ENSMUSG00000048138
AA Change: T218N

DomainStartEndE-ValueType
low complexity region 38 74 N/A INTRINSIC
low complexity region 78 115 N/A INTRINSIC
DM 119 172 5.2e-28 SMART
low complexity region 224 229 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display perinatal lethality due to breathing difficulties, multiple axial skeletal defects including kinked tails and rib and vertebral malformations, and abnormal somite organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Ankrd26 A T 6: 118,556,243 F198L probably benign Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cers1 T A 8: 70,322,636 H233Q probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Ddt C T 10: 75,772,763 E42K probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Gprasp1 A T X: 135,799,759 M234L probably benign Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Mov10 T C 3: 104,799,724 E653G probably damaging Het
Olfr916 C T 9: 38,658,011 C127Y possibly damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sorcs1 T C 19: 50,210,650 E825G possibly damaging Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Dmrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmrt2 APN 19 25678134 missense probably damaging 1.00
IGL02269:Dmrt2 APN 19 25678459 missense probably benign 0.01
IGL02740:Dmrt2 APN 19 25678473 missense possibly damaging 0.84
R0141:Dmrt2 UTSW 19 25678291 missense possibly damaging 0.52
R0294:Dmrt2 UTSW 19 25678071 missense probably damaging 1.00
R0352:Dmrt2 UTSW 19 25678662 missense probably damaging 1.00
R0514:Dmrt2 UTSW 19 25675655 critical splice donor site probably null
R1016:Dmrt2 UTSW 19 25675574 missense probably damaging 0.99
R1104:Dmrt2 UTSW 19 25678616 missense probably benign 0.01
R1164:Dmrt2 UTSW 19 25677993 missense possibly damaging 0.89
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R3109:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R4029:Dmrt2 UTSW 19 25678134 missense probably damaging 0.99
R4841:Dmrt2 UTSW 19 25677667 missense probably damaging 1.00
R5317:Dmrt2 UTSW 19 25673480 missense probably benign 0.00
R6335:Dmrt2 UTSW 19 25673571 missense possibly damaging 0.73
R6554:Dmrt2 UTSW 19 25677948 missense probably damaging 1.00
R6752:Dmrt2 UTSW 19 25678342 missense probably damaging 0.96
X0058:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0060:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0063:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
Z1088:Dmrt2 UTSW 19 25678642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGAAGCTACCATATGGGAAC -3'
(R):5'- TTGTAGGAACTGTACTCGGGTC -3'

Sequencing Primer
(F):5'- CGGAAGCTACCATATGGGAACTATTC -3'
(R):5'- TCCAGGCACCATACGGTTG -3'
Posted On2015-02-05