Incidental Mutation 'R3109:Klhdc4'
ID263706
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission 040583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R3109 (G1)
Quality Score202
Status Validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 121821334 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 72 (H72Q)
Ref Sequence ENSEMBL: ENSMUSP00000134361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000174192] [ENSMUST00000174255] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect probably damaging
Transcript: ENSMUST00000045884
AA Change: H72Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: H72Q

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172470
Predicted Effect probably benign
Transcript: ENSMUST00000174192
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174255
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174709
Predicted Effect probably damaging
Transcript: ENSMUST00000174717
AA Change: H72Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: H72Q

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,442,456 E323G probably damaging Het
Adamts20 T C 15: 94,345,904 probably benign Het
Alkbh3 T C 2: 94,004,763 E80G probably damaging Het
Amfr T C 8: 94,000,306 Y93C probably damaging Het
Arid2 T C 15: 96,356,746 Y158H probably damaging Het
Camk1g T C 1: 193,354,993 Y133C probably damaging Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd1b G A 1: 139,041,916 probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Igfn1 T C 1: 135,997,848 D56G probably benign Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Kmt2c A G 5: 25,275,735 Y1459H probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Per2 A T 1: 91,445,575 C164S probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbl2 T A 8: 91,102,235 I588N probably benign Het
Rslcan18 C T 13: 67,098,607 E314K possibly damaging Het
Ubr3 A T 2: 69,988,840 T1325S probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGACACTTAGCATGTGGGAG -3'
(R):5'- AGAGCTTGCATGTCGTCCTG -3'

Sequencing Primer
(F):5'- CTTAGCATGTGGGAGCGCAAG -3'
(R):5'- AGCGTGCCTAGTTGCAG -3'
Posted On2015-02-05