Incidental Mutation 'R3109:Arid2'
ID 263714
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene Name AT-rich interaction domain 2
Synonyms 1700124K17Rik, zipzap/p200, 4432409D24Rik
MMRRC Submission 040583-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3109 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 96185399-96302873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96254627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 158 (Y158H)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250] [ENSMUST00000134985]
AlphaFold E9Q7E2
Predicted Effect probably damaging
Transcript: ENSMUST00000096250
AA Change: Y158H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: Y158H

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134985
SMART Domains Protein: ENSMUSP00000135829
Gene: ENSMUSG00000033237

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175735
Meta Mutation Damage Score 0.7623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,284,376 (GRCm39) E323G probably damaging Het
Adamts20 T C 15: 94,243,785 (GRCm39) probably benign Het
Alkbh3 T C 2: 93,835,108 (GRCm39) E80G probably damaging Het
Amfr T C 8: 94,726,934 (GRCm39) Y93C probably damaging Het
Camk1g T C 1: 193,037,301 (GRCm39) Y133C probably damaging Het
Cnnm1 T C 19: 43,430,000 (GRCm39) C373R probably damaging Het
Cnot1 A G 8: 96,462,377 (GRCm39) V1691A probably damaging Het
Cubn T C 2: 13,367,158 (GRCm39) S1571G possibly damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dennd1b G A 1: 138,969,654 (GRCm39) probably benign Het
Dmrt2 C A 19: 25,655,055 (GRCm39) T218N probably benign Het
Drd4 T A 7: 140,872,195 (GRCm39) V82E possibly damaging Het
Fat1 G A 8: 45,498,210 (GRCm39) probably null Het
Fyn G C 10: 39,427,451 (GRCm39) D445H probably damaging Het
Igfn1 T C 1: 135,925,586 (GRCm39) D56G probably benign Het
Igkv11-125 T C 6: 67,890,855 (GRCm39) F58L possibly damaging Het
Klhdc4 A C 8: 122,548,073 (GRCm39) H72Q probably damaging Het
Kmt2c A G 5: 25,480,733 (GRCm39) Y1459H probably damaging Het
Lama2 C T 10: 26,877,231 (GRCm39) E2652K probably benign Het
Muc5b C T 7: 141,412,496 (GRCm39) T1814M unknown Het
Ntrk3 C T 7: 78,110,263 (GRCm39) V324M probably benign Het
Or52s1b T A 7: 102,822,293 (GRCm39) M184L probably damaging Het
Per2 A T 1: 91,373,297 (GRCm39) C164S probably benign Het
Ptprn2 A G 12: 116,839,800 (GRCm39) D441G probably benign Het
Rbl2 T A 8: 91,828,863 (GRCm39) I588N probably benign Het
Rslcan18 C T 13: 67,246,671 (GRCm39) E314K possibly damaging Het
Ubr3 A T 2: 69,819,184 (GRCm39) T1325S probably damaging Het
Unc45a A G 7: 79,981,294 (GRCm39) probably benign Het
Vmn1r175 A G 7: 23,508,393 (GRCm39) V78A probably benign Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96,270,183 (GRCm39) missense probably benign
IGL00321:Arid2 APN 15 96,186,970 (GRCm39) missense probably damaging 0.97
IGL00434:Arid2 APN 15 96,269,181 (GRCm39) missense probably damaging 0.99
IGL00576:Arid2 APN 15 96,254,639 (GRCm39) missense probably damaging 0.99
IGL00766:Arid2 APN 15 96,268,286 (GRCm39) missense probably benign 0.09
IGL01563:Arid2 APN 15 96,270,278 (GRCm39) missense probably damaging 0.99
IGL01697:Arid2 APN 15 96,259,453 (GRCm39) critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96,254,678 (GRCm39) missense probably damaging 1.00
IGL02159:Arid2 APN 15 96,256,793 (GRCm39) splice site probably benign
IGL02341:Arid2 APN 15 96,270,066 (GRCm39) missense probably benign
IGL02416:Arid2 APN 15 96,247,936 (GRCm39) missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96,270,116 (GRCm39) missense probably benign 0.00
IGL02598:Arid2 APN 15 96,269,417 (GRCm39) missense probably damaging 1.00
IGL02644:Arid2 APN 15 96,266,589 (GRCm39) missense probably damaging 1.00
IGL02653:Arid2 APN 15 96,185,583 (GRCm39) missense probably damaging 0.99
IGL03115:Arid2 APN 15 96,268,154 (GRCm39) missense probably damaging 1.00
IGL03137:Arid2 APN 15 96,269,199 (GRCm39) missense probably benign 0.44
IGL03220:Arid2 APN 15 96,259,653 (GRCm39) missense probably damaging 0.99
IGL03249:Arid2 APN 15 96,299,846 (GRCm39) missense probably damaging 1.00
IGL03256:Arid2 APN 15 96,268,643 (GRCm39) missense probably benign 0.18
IGL03386:Arid2 APN 15 96,259,455 (GRCm39) missense probably damaging 1.00
H8562:Arid2 UTSW 15 96,267,427 (GRCm39) missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96,267,392 (GRCm39) missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96,268,452 (GRCm39) missense probably damaging 0.97
R0284:Arid2 UTSW 15 96,276,848 (GRCm39) splice site probably benign
R0347:Arid2 UTSW 15 96,268,833 (GRCm39) missense probably benign 0.01
R0366:Arid2 UTSW 15 96,259,601 (GRCm39) splice site probably benign
R0400:Arid2 UTSW 15 96,254,806 (GRCm39) unclassified probably benign
R0650:Arid2 UTSW 15 96,299,930 (GRCm39) missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96,299,930 (GRCm39) missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96,267,386 (GRCm39) missense probably benign 0.01
R1615:Arid2 UTSW 15 96,269,535 (GRCm39) missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96,268,064 (GRCm39) missense probably benign 0.01
R2024:Arid2 UTSW 15 96,259,680 (GRCm39) missense probably damaging 1.00
R2046:Arid2 UTSW 15 96,267,268 (GRCm39) missense probably damaging 1.00
R2069:Arid2 UTSW 15 96,260,471 (GRCm39) missense probably damaging 1.00
R2149:Arid2 UTSW 15 96,268,716 (GRCm39) missense probably damaging 1.00
R2300:Arid2 UTSW 15 96,299,887 (GRCm39) missense probably damaging 1.00
R2336:Arid2 UTSW 15 96,260,430 (GRCm39) missense probably damaging 1.00
R2359:Arid2 UTSW 15 96,259,759 (GRCm39) missense probably damaging 1.00
R2368:Arid2 UTSW 15 96,247,893 (GRCm39) missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96,267,335 (GRCm39) missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96,259,817 (GRCm39) missense probably damaging 1.00
R3765:Arid2 UTSW 15 96,268,595 (GRCm39) missense probably benign 0.01
R3785:Arid2 UTSW 15 96,270,439 (GRCm39) missense possibly damaging 0.83
R3811:Arid2 UTSW 15 96,186,967 (GRCm39) missense probably benign 0.01
R3812:Arid2 UTSW 15 96,186,967 (GRCm39) missense probably benign 0.01
R3813:Arid2 UTSW 15 96,267,831 (GRCm39) missense probably benign 0.26
R3843:Arid2 UTSW 15 96,249,721 (GRCm39) missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96,261,503 (GRCm39) missense probably damaging 1.00
R4279:Arid2 UTSW 15 96,269,637 (GRCm39) missense probably damaging 1.00
R4569:Arid2 UTSW 15 96,290,343 (GRCm39) missense probably damaging 1.00
R4597:Arid2 UTSW 15 96,268,737 (GRCm39) missense probably damaging 1.00
R5020:Arid2 UTSW 15 96,269,869 (GRCm39) missense probably damaging 0.96
R5154:Arid2 UTSW 15 96,299,866 (GRCm39) missense probably damaging 1.00
R5303:Arid2 UTSW 15 96,290,349 (GRCm39) missense probably damaging 1.00
R5620:Arid2 UTSW 15 96,270,387 (GRCm39) missense probably benign 0.20
R5766:Arid2 UTSW 15 96,270,086 (GRCm39) missense probably benign 0.01
R6005:Arid2 UTSW 15 96,268,853 (GRCm39) missense probably benign
R6169:Arid2 UTSW 15 96,266,558 (GRCm39) missense probably benign 0.36
R6216:Arid2 UTSW 15 96,254,790 (GRCm39) missense probably benign 0.18
R6392:Arid2 UTSW 15 96,259,483 (GRCm39) missense probably damaging 0.99
R6430:Arid2 UTSW 15 96,261,575 (GRCm39) missense probably benign
R6454:Arid2 UTSW 15 96,270,294 (GRCm39) missense probably benign 0.20
R6672:Arid2 UTSW 15 96,260,226 (GRCm39) missense probably benign 0.30
R6776:Arid2 UTSW 15 96,268,830 (GRCm39) missense probably benign 0.00
R6985:Arid2 UTSW 15 96,268,029 (GRCm39) missense probably benign 0.06
R7132:Arid2 UTSW 15 96,247,894 (GRCm39) missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96,276,756 (GRCm39) missense probably damaging 0.99
R7453:Arid2 UTSW 15 96,268,605 (GRCm39) missense probably benign
R7562:Arid2 UTSW 15 96,299,849 (GRCm39) missense probably damaging 1.00
R7594:Arid2 UTSW 15 96,288,875 (GRCm39) missense probably damaging 1.00
R7692:Arid2 UTSW 15 96,254,578 (GRCm39) nonsense probably null
R7792:Arid2 UTSW 15 96,267,256 (GRCm39) missense probably benign 0.05
R8036:Arid2 UTSW 15 96,266,625 (GRCm39) missense probably damaging 1.00
R8094:Arid2 UTSW 15 96,266,592 (GRCm39) missense possibly damaging 0.86
R8327:Arid2 UTSW 15 96,260,485 (GRCm39) missense probably damaging 1.00
R9065:Arid2 UTSW 15 96,269,372 (GRCm39) missense probably benign 0.44
R9143:Arid2 UTSW 15 96,259,715 (GRCm39) missense probably damaging 0.99
R9320:Arid2 UTSW 15 96,269,067 (GRCm39) missense probably damaging 1.00
R9346:Arid2 UTSW 15 96,185,792 (GRCm39) missense probably benign 0.01
R9519:Arid2 UTSW 15 96,186,948 (GRCm39) missense possibly damaging 0.46
R9651:Arid2 UTSW 15 96,256,822 (GRCm39) missense probably benign 0.44
X0024:Arid2 UTSW 15 96,270,371 (GRCm39) missense probably benign 0.00
X0066:Arid2 UTSW 15 96,254,685 (GRCm39) missense probably damaging 1.00
Z1177:Arid2 UTSW 15 96,288,867 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGAAAAGTTGAGAATTGGACC -3'
(R):5'- TTACTGTCATCGAACACCCC -3'

Sequencing Primer
(F):5'- TAGCAGAGAGTAGCTATAGTCCTCC -3'
(R):5'- TCATCGAACACCCCCGCATTAG -3'
Posted On 2015-02-05