Incidental Mutation 'R3109:Dmrt2'
ID263715
Institutional Source Beutler Lab
Gene Symbol Dmrt2
Ensembl Gene ENSMUSG00000048138
Gene Namedoublesex and mab-3 related transcription factor 2
SynonymsTerra
MMRRC Submission 040583-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3109 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location25672420-25679010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25677691 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 218 (T218N)
Ref Sequence ENSEMBL: ENSMUSP00000059654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053068]
Predicted Effect probably benign
Transcript: ENSMUST00000053068
AA Change: T218N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000059654
Gene: ENSMUSG00000048138
AA Change: T218N

DomainStartEndE-ValueType
low complexity region 38 74 N/A INTRINSIC
low complexity region 78 115 N/A INTRINSIC
DM 119 172 5.2e-28 SMART
low complexity region 224 229 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display perinatal lethality due to breathing difficulties, multiple axial skeletal defects including kinked tails and rib and vertebral malformations, and abnormal somite organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,442,456 E323G probably damaging Het
Adamts20 T C 15: 94,345,904 probably benign Het
Alkbh3 T C 2: 94,004,763 E80G probably damaging Het
Amfr T C 8: 94,000,306 Y93C probably damaging Het
Arid2 T C 15: 96,356,746 Y158H probably damaging Het
Camk1g T C 1: 193,354,993 Y133C probably damaging Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd1b G A 1: 139,041,916 probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Igfn1 T C 1: 135,997,848 D56G probably benign Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Klhdc4 A C 8: 121,821,334 H72Q probably damaging Het
Kmt2c A G 5: 25,275,735 Y1459H probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Per2 A T 1: 91,445,575 C164S probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbl2 T A 8: 91,102,235 I588N probably benign Het
Rslcan18 C T 13: 67,098,607 E314K possibly damaging Het
Ubr3 A T 2: 69,988,840 T1325S probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Other mutations in Dmrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmrt2 APN 19 25678134 missense probably damaging 1.00
IGL02269:Dmrt2 APN 19 25678459 missense probably benign 0.01
IGL02740:Dmrt2 APN 19 25678473 missense possibly damaging 0.84
R0141:Dmrt2 UTSW 19 25678291 missense possibly damaging 0.52
R0294:Dmrt2 UTSW 19 25678071 missense probably damaging 1.00
R0352:Dmrt2 UTSW 19 25678662 missense probably damaging 1.00
R0514:Dmrt2 UTSW 19 25675655 critical splice donor site probably null
R1016:Dmrt2 UTSW 19 25675574 missense probably damaging 0.99
R1104:Dmrt2 UTSW 19 25678616 missense probably benign 0.01
R1164:Dmrt2 UTSW 19 25677993 missense possibly damaging 0.89
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R1467:Dmrt2 UTSW 19 25673606 missense possibly damaging 0.72
R3107:Dmrt2 UTSW 19 25677691 missense probably benign 0.01
R4029:Dmrt2 UTSW 19 25678134 missense probably damaging 0.99
R4841:Dmrt2 UTSW 19 25677667 missense probably damaging 1.00
R5317:Dmrt2 UTSW 19 25673480 missense probably benign 0.00
R6335:Dmrt2 UTSW 19 25673571 missense possibly damaging 0.73
R6554:Dmrt2 UTSW 19 25677948 missense probably damaging 1.00
R6752:Dmrt2 UTSW 19 25678342 missense probably damaging 0.96
X0058:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0060:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
X0063:Dmrt2 UTSW 19 25673830 missense possibly damaging 0.95
Z1088:Dmrt2 UTSW 19 25678642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAGCTACCATATGGGAAC -3'
(R):5'- TTGTAGGAACTGTACTCGGGTC -3'

Sequencing Primer
(F):5'- CGGAAGCTACCATATGGGAACTATTC -3'
(R):5'- TCCAGGCACCATACGGTTG -3'
Posted On2015-02-05