Mutagenetix > Incidental Mutation

Incidental Mutation 'R3111:Ptprf'

263769

Institutional Source

Beutler Lab

Gene Symbol

Ptprf

Ensembl Gene

ENSMUSG00000033295

Gene Name

protein tyrosine phosphatase receptor type F

Synonyms

RPTP-LAR, LAR

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.657) question?

Stock #

R3111 ()

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118065410-118148602 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118068629 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1713 (D1713G)

Ref Sequence

ENSEMBL: ENSMUSP00000039368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049074]

AlphaFold

A2A8L5

PDB Structure

Tandem Ig domains of tyrosine phosphatase LAR [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049074
AA Change: D1713G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: D1713G

Domain	Start	End	E-Value	Type
IGc2	45	114	2.64e-12	SMART
IGc2	147	214	1.48e-15	SMART
IG	238	316	1.06e-11	SMART
FN3	319	398	6.9e-14	SMART
FN3	414	497	5.73e-11	SMART
FN3	512	591	4.06e-11	SMART
FN3	606	693	8.69e-11	SMART
FN3	709	797	8.83e-12	SMART
FN3	812	892	3.2e-9	SMART
FN3	907	988	2.53e-12	SMART
FN3	1003	1079	3.48e-1	SMART
coiled coil region	1146	1175	N/A	INTRINSIC
transmembrane domain	1253	1275	N/A	INTRINSIC
PTPc	1342	1600	1.12e-138	SMART
PTPc	1629	1891	3.4e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123484

Predicted Effect

unknown
Transcript: ENSMUST00000124758
AA Change: D1146G

SMART Domains

Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295
AA Change: D1146G

Domain	Start	End	E-Value	Type
FN3	37	116	4.06e-11	SMART
FN3	132	220	8.83e-12	SMART
FN3	235	315	3.2e-9	SMART
FN3	330	411	2.53e-12	SMART
FN3	426	502	3.48e-1	SMART
coiled coil region	568	597	N/A	INTRINSIC
transmembrane domain	676	698	N/A	INTRINSIC
PTPc	776	1034	1.12e-138	SMART
PTPc	1063	1325	3.4e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127616

Predicted Effect

unknown
Transcript: ENSMUST00000150096
AA Change: D1105G

SMART Domains

Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295
AA Change: D1105G

Domain	Start	End	E-Value	Type
FN3	14	66	2.7e1	SMART
FN3	82	165	5.73e-11	SMART
FN3	180	259	4.06e-11	SMART
FN3	275	372	6.69e-12	SMART
FN3	385	461	2.83e-1	SMART
coiled coil region	527	556	N/A	INTRINSIC
transmembrane domain	635	657	N/A	INTRINSIC
PTPc	735	993	1.12e-138	SMART
PTPc	1022	1284	3.4e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184953

Coding Region Coverage

1x: 98.8%
3x: 98.4%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	A	11: 110,069,655 (GRCm39)	K1554*	probably null	Het
Car12	C	T	9: 66,661,008 (GRCm39)	T124I	probably damaging	Het
Ccdc180	T	A	4: 45,900,470 (GRCm39)	I278K	possibly damaging	Het
Disp1	A	T	1: 182,869,087 (GRCm39)	M1111K	probably damaging	Het
Fpr1	A	T	17: 18,096,897 (GRCm39)	M364K	probably benign	Het
Gad1-ps	A	G	10: 99,280,383 (GRCm39)		noncoding transcript	Het
Grn	A	G	11: 102,324,069 (GRCm39)	T53A	probably benign	Het
Hmgxb3	T	C	18: 61,280,454 (GRCm39)	N683S	probably damaging	Het
Jarid2	T	A	13: 45,059,752 (GRCm39)	N661K	probably damaging	Het
Mfap3	T	C	11: 57,420,406 (GRCm39)	V129A	probably damaging	Het
Mip	T	A	10: 128,061,875 (GRCm39)	L42*	probably null	Het
Myh4	T	A	11: 67,137,276 (GRCm39)	L499Q	possibly damaging	Het
Ncln	C	T	10: 81,323,519 (GRCm39)	V51I	probably benign	Het
Nmnat3	T	A	9: 98,281,533 (GRCm39)	I45N	probably damaging	Het
Or1e32	T	C	11: 73,705,012 (GRCm39)	R299G	probably benign	Het
Osbpl9	T	C	4: 108,940,290 (GRCm39)	I232V	probably benign	Het
Pcdha12	A	T	18: 37,155,243 (GRCm39)	H654L	probably damaging	Het
Pcmtd2	A	T	2: 181,496,922 (GRCm39)	I300F	probably damaging	Het
Pds5b	T	C	5: 150,643,372 (GRCm39)	S65P	probably damaging	Het
Pgm1	C	T	4: 99,813,222 (GRCm39)	T11I	probably benign	Het
Phf24	G	A	4: 42,938,316 (GRCm39)	V226I	probably benign	Het
Pigo	T	C	4: 43,021,083 (GRCm39)	T612A	probably benign	Het
Plekhh3	T	C	11: 101,054,973 (GRCm39)		probably benign	Het
Rbp3	G	T	14: 33,676,069 (GRCm39)	V6F	probably benign	Het
Sac3d1	T	C	19: 6,168,387 (GRCm39)	K77R	probably benign	Het
Slc1a6	T	A	10: 78,624,915 (GRCm39)	S107T	probably damaging	Het
Syce1l	A	G	8: 114,381,579 (GRCm39)	Q164R	probably benign	Het
Tgfbi	T	C	13: 56,757,547 (GRCm39)	Y30H	probably damaging	Het
Tmem217	A	T	17: 29,745,532 (GRCm39)	V66D	probably damaging	Het
Tnn	C	A	1: 159,934,625 (GRCm39)	D1263Y	probably damaging	Het
Ylpm1	T	C	12: 85,076,145 (GRCm39)	F499L	probably damaging	Het

Other mutations in Ptprf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ptprf	APN	4	118,080,417 (GRCm39)	splice site	probably benign
IGL01337:Ptprf	APN	4	118,093,488 (GRCm39)	missense	probably damaging	1.00
IGL01482:Ptprf	APN	4	118,069,651 (GRCm39)	missense	probably damaging	1.00
IGL01743:Ptprf	APN	4	118,106,095 (GRCm39)	critical splice donor site	probably null
IGL01987:Ptprf	APN	4	118,134,567 (GRCm39)	missense	probably benign
IGL02189:Ptprf	APN	4	118,070,839 (GRCm39)	splice site	probably benign
IGL03067:Ptprf	APN	4	118,067,910 (GRCm39)	missense	possibly damaging	0.67
PIT4677001:Ptprf	UTSW	4	118,070,809 (GRCm39)	missense	probably damaging	1.00
R0382:Ptprf	UTSW	4	118,080,591 (GRCm39)	splice site	probably benign
R0788:Ptprf	UTSW	4	118,083,663 (GRCm39)	missense	probably damaging	0.97
R1164:Ptprf	UTSW	4	118,114,689 (GRCm39)	missense	probably damaging	1.00
R1478:Ptprf	UTSW	4	118,069,302 (GRCm39)	nonsense	probably null
R1483:Ptprf	UTSW	4	118,093,161 (GRCm39)	missense	possibly damaging	0.81
R1611:Ptprf	UTSW	4	118,093,430 (GRCm39)	missense	probably benign	0.34
R1721:Ptprf	UTSW	4	118,082,096 (GRCm39)	missense	possibly damaging	0.56
R1817:Ptprf	UTSW	4	118,080,462 (GRCm39)	missense	probably benign	0.02
R1818:Ptprf	UTSW	4	118,067,068 (GRCm39)	missense	probably damaging	1.00
R1860:Ptprf	UTSW	4	118,081,129 (GRCm39)	missense	probably damaging	1.00
R2208:Ptprf	UTSW	4	118,126,369 (GRCm39)	splice site	probably benign
R2406:Ptprf	UTSW	4	118,126,501 (GRCm39)	missense	possibly damaging	0.62
R2912:Ptprf	UTSW	4	118,106,177 (GRCm39)	missense	probably damaging	0.98
R3498:Ptprf	UTSW	4	118,082,127 (GRCm39)	missense	probably damaging	0.99
R3499:Ptprf	UTSW	4	118,082,127 (GRCm39)	missense	probably damaging	0.99
R3615:Ptprf	UTSW	4	118,095,080 (GRCm39)	missense	probably benign	0.04
R3616:Ptprf	UTSW	4	118,095,080 (GRCm39)	missense	probably benign	0.04
R4038:Ptprf	UTSW	4	118,114,805 (GRCm39)	missense	probably damaging	1.00
R4243:Ptprf	UTSW	4	118,083,649 (GRCm39)	critical splice donor site	probably null
R4260:Ptprf	UTSW	4	118,083,280 (GRCm39)	missense	possibly damaging	0.64
R4693:Ptprf	UTSW	4	118,068,219 (GRCm39)	missense	probably benign	0.16
R4726:Ptprf	UTSW	4	118,069,414 (GRCm39)	missense	possibly damaging	0.86
R4746:Ptprf	UTSW	4	118,082,236 (GRCm39)	missense	possibly damaging	0.83
R4802:Ptprf	UTSW	4	118,067,526 (GRCm39)	intron	probably benign
R4857:Ptprf	UTSW	4	118,074,394 (GRCm39)	splice site	probably benign
R5071:Ptprf	UTSW	4	118,069,196 (GRCm39)	missense	probably damaging	1.00
R5221:Ptprf	UTSW	4	118,082,305 (GRCm39)	missense	probably benign	0.00
R5327:Ptprf	UTSW	4	118,093,586 (GRCm39)	missense	probably damaging	1.00
R5336:Ptprf	UTSW	4	118,092,831 (GRCm39)	missense	probably damaging	1.00
R5356:Ptprf	UTSW	4	118,083,535 (GRCm39)	missense	probably benign	0.00
R5373:Ptprf	UTSW	4	118,083,238 (GRCm39)	missense	possibly damaging	0.93
R5555:Ptprf	UTSW	4	118,082,121 (GRCm39)	missense	probably damaging	1.00
R5693:Ptprf	UTSW	4	118,093,374 (GRCm39)	nonsense	probably null
R5860:Ptprf	UTSW	4	118,068,486 (GRCm39)	intron	probably benign
R5869:Ptprf	UTSW	4	118,067,579 (GRCm39)	missense	probably damaging	1.00
R5890:Ptprf	UTSW	4	118,081,932 (GRCm39)	missense	probably benign
R5932:Ptprf	UTSW	4	118,068,964 (GRCm39)	missense	probably benign	0.10
R6028:Ptprf	UTSW	4	118,070,826 (GRCm39)	missense	probably benign	0.01
R6030:Ptprf	UTSW	4	118,068,245 (GRCm39)	missense	probably benign	0.19
R6030:Ptprf	UTSW	4	118,068,245 (GRCm39)	missense	probably benign	0.19
R6088:Ptprf	UTSW	4	118,067,952 (GRCm39)	missense	possibly damaging	0.68
R6089:Ptprf	UTSW	4	118,068,281 (GRCm39)	missense	probably damaging	0.99
R6108:Ptprf	UTSW	4	118,080,453 (GRCm39)	missense	probably benign	0.01
R6320:Ptprf	UTSW	4	118,070,011 (GRCm39)	missense	probably benign
R6741:Ptprf	UTSW	4	118,080,565 (GRCm39)	missense	probably benign	0.00
R6744:Ptprf	UTSW	4	118,093,562 (GRCm39)	missense	probably benign	0.00
R6750:Ptprf	UTSW	4	118,088,928 (GRCm39)	missense	probably benign	0.03
R6906:Ptprf	UTSW	4	118,126,474 (GRCm39)	missense	possibly damaging	0.95
R7021:Ptprf	UTSW	4	118,081,101 (GRCm39)	missense	probably benign	0.00
R7153:Ptprf	UTSW	4	118,088,740 (GRCm39)	missense	probably damaging	1.00
R7326:Ptprf	UTSW	4	118,088,866 (GRCm39)	missense	probably damaging	0.99
R7337:Ptprf	UTSW	4	118,068,322 (GRCm39)	missense	probably damaging	0.99
R7374:Ptprf	UTSW	4	118,114,689 (GRCm39)	missense	probably damaging	1.00
R7375:Ptprf	UTSW	4	118,070,011 (GRCm39)	missense	probably benign
R7399:Ptprf	UTSW	4	118,083,720 (GRCm39)	missense	probably benign	0.28
R7417:Ptprf	UTSW	4	118,069,369 (GRCm39)	missense	probably damaging	1.00
R7448:Ptprf	UTSW	4	118,092,864 (GRCm39)	missense	probably benign	0.03
R7530:Ptprf	UTSW	4	118,069,945 (GRCm39)	missense	probably damaging	1.00
R7593:Ptprf	UTSW	4	118,069,593 (GRCm39)	missense	probably benign	0.00
R8172:Ptprf	UTSW	4	118,068,275 (GRCm39)	missense	probably benign	0.03
R8239:Ptprf	UTSW	4	118,069,309 (GRCm39)	missense	possibly damaging	0.88
R8257:Ptprf	UTSW	4	118,083,476 (GRCm39)	missense	probably damaging	0.96
R8331:Ptprf	UTSW	4	118,083,263 (GRCm39)	missense	probably benign	0.27
R8441:Ptprf	UTSW	4	118,075,255 (GRCm39)	splice site	probably benign
R8681:Ptprf	UTSW	4	118,088,844 (GRCm39)	missense	probably benign	0.02
R8771:Ptprf	UTSW	4	118,068,987 (GRCm39)	missense	possibly damaging	0.95
R8815:Ptprf	UTSW	4	118,095,125 (GRCm39)	missense	possibly damaging	0.52
R8998:Ptprf	UTSW	4	118,083,671 (GRCm39)	missense	probably benign	0.00
R8999:Ptprf	UTSW	4	118,083,671 (GRCm39)	missense	probably benign	0.00
R9389:Ptprf	UTSW	4	118,093,236 (GRCm39)	missense	probably benign
R9508:Ptprf	UTSW	4	118,126,776 (GRCm39)	nonsense	probably null
R9581:Ptprf	UTSW	4	118,092,257 (GRCm39)	missense	probably benign	0.00
X0067:Ptprf	UTSW	4	118,093,223 (GRCm39)	missense	possibly damaging	0.85
Z1177:Ptprf	UTSW	4	118,126,812 (GRCm39)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AAAGAGGTCTGAGGCCATGC -3'
(R):5'- TTGGGAGAGTTAAGAGCTAATCC -3'

Sequencing Primer
(F):5'- AGGTCTGAGGCCATGCTGATG -3'
(R):5'- CTAATCCAAAAGATCAGAGTGAGTTG -3'

Posted On

2015-02-05