Incidental Mutation 'R3111:Nmnat3'
ID263776
Institutional Source Beutler Lab
Gene Symbol Nmnat3
Ensembl Gene ENSMUSG00000032456
Gene Namenicotinamide nucleotide adenylyltransferase 3
SynonymsPNAT3, 4933408N02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3111 ()
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location98287435-98420438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98399480 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 45 (I45N)
Ref Sequence ENSEMBL: ENSMUSP00000141111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112935] [ENSMUST00000112937] [ENSMUST00000112938] [ENSMUST00000134253]
Predicted Effect probably damaging
Transcript: ENSMUST00000035031
AA Change: I45N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035031
Gene: ENSMUSG00000032456
AA Change: I45N

DomainStartEndE-ValueType
Pfam:CTP_transf_like 10 207 8.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112935
AA Change: I45N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108557
Gene: ENSMUSG00000032456
AA Change: I45N

DomainStartEndE-ValueType
Pfam:CTP_transf_2 3 97 2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112937
SMART Domains Protein: ENSMUSP00000108559
Gene: ENSMUSG00000032456

DomainStartEndE-ValueType
Pfam:CTP_transf_2 1 141 7.6e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112938
AA Change: I45N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108560
Gene: ENSMUSG00000032456
AA Change: I45N

DomainStartEndE-ValueType
Pfam:CTP_transf_2 10 121 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134253
AA Change: I45N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141111
Gene: ENSMUSG00000032456
AA Change: I45N

DomainStartEndE-ValueType
Pfam:CTP_transf_2 10 55 4.3e-13 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit splenomegaly and hemolytic anemia resulting from a glycolysis pathway blockade. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,178,829 K1554* probably null Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Disp1 A T 1: 183,087,523 M1111K probably damaging Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gad1-ps A G 10: 99,444,521 noncoding transcript Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Mfap3 T C 11: 57,529,580 V129A probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Myh4 T A 11: 67,246,450 L499Q possibly damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Olfr392 T C 11: 73,814,186 R299G probably benign Het
Osbpl9 T C 4: 109,083,093 I232V probably benign Het
Pcdha12 A T 18: 37,022,190 H654L probably damaging Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pds5b T C 5: 150,719,907 S65P probably damaging Het
Pgm2 C T 4: 99,956,025 T11I probably benign Het
Phf24 G A 4: 42,938,316 V226I probably benign Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ptprf T C 4: 118,211,432 D1713G probably damaging Het
Rbp3 G T 14: 33,954,112 V6F probably benign Het
Sac3d1 T C 19: 6,118,357 K77R probably benign Het
Slc1a6 T A 10: 78,789,081 S107T probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Tgfbi T C 13: 56,609,734 Y30H probably damaging Het
Tmem217 A T 17: 29,526,558 V66D probably damaging Het
Tnn C A 1: 160,107,055 D1263Y probably damaging Het
Ylpm1 T C 12: 85,029,371 F499L probably damaging Het
Other mutations in Nmnat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03406:Nmnat3 APN 9 98399477 missense probably damaging 1.00
PIT4466001:Nmnat3 UTSW 9 98410253 missense probably benign 0.39
R1564:Nmnat3 UTSW 9 98354166 critical splice donor site probably null
R1780:Nmnat3 UTSW 9 98354111 missense probably damaging 1.00
R1832:Nmnat3 UTSW 9 98399468 missense probably damaging 0.97
R1981:Nmnat3 UTSW 9 98410299 missense possibly damaging 0.93
R3711:Nmnat3 UTSW 9 98410223 missense probably damaging 1.00
R4355:Nmnat3 UTSW 9 98410152 missense possibly damaging 0.88
R7055:Nmnat3 UTSW 9 98410233 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAAGCTTCCACTCTGAGGC -3'
(R):5'- GACTCTGTTACCTCAGCACC -3'

Sequencing Primer
(F):5'- TTCCACTCTGAGGCATAGAGGAC -3'
(R):5'- GTTACCTCAGCACCTTCACCG -3'
Posted On2015-02-05