Incidental Mutation 'R3111:Sac3d1'
ID263800
Institutional Source Beutler Lab
Gene Symbol Sac3d1
Ensembl Gene ENSMUSG00000024790
Gene NameSAC3 domain containing 1
Synonyms2410004C24Rik, Shd1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R3111 ()
Quality Score138
Status Not validated
Chromosome19
Chromosomal Location6116004-6118586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6118357 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 77 (K77R)
Ref Sequence ENSEMBL: ENSMUSP00000109161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025702] [ENSMUST00000044451] [ENSMUST00000113533] [ENSMUST00000138931] [ENSMUST00000154601]
Predicted Effect probably benign
Transcript: ENSMUST00000025702
SMART Domains Protein: ENSMUSP00000025702
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
MIT 265 337 7.77e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044451
SMART Domains Protein: ENSMUSP00000044231
Gene: ENSMUSG00000054999

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Pfam:PA 163 256 3e-12 PFAM
Pfam:Peptidase_M28 353 564 1.3e-22 PFAM
low complexity region 579 592 N/A INTRINSIC
Pfam:TFR_dimer 621 740 4.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113533
AA Change: K77R

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109161
Gene: ENSMUSG00000024790
AA Change: K77R

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:SAC3_GANP 134 356 7.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129076
Predicted Effect probably benign
Transcript: ENSMUST00000138931
SMART Domains Protein: ENSMUSP00000114189
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 112 1.69e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150718
Predicted Effect probably benign
Transcript: ENSMUST00000154601
SMART Domains Protein: ENSMUSP00000122740
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
Blast:MIT 222 251 4e-12 BLAST
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygote for a null allele had increased numbers of myeloid and erythroid progenitor cells. Mice homozygote for a null allele had these features plus mild spleen and thymus hyperplasia, an increased T cell proliferative response, and enhanced IgM secretion by B cells to IL-5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,178,829 K1554* probably null Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Disp1 A T 1: 183,087,523 M1111K probably damaging Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gad1-ps A G 10: 99,444,521 noncoding transcript Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Mfap3 T C 11: 57,529,580 V129A probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Myh4 T A 11: 67,246,450 L499Q possibly damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nmnat3 T A 9: 98,399,480 I45N probably damaging Het
Olfr392 T C 11: 73,814,186 R299G probably benign Het
Osbpl9 T C 4: 109,083,093 I232V probably benign Het
Pcdha12 A T 18: 37,022,190 H654L probably damaging Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pds5b T C 5: 150,719,907 S65P probably damaging Het
Pgm2 C T 4: 99,956,025 T11I probably benign Het
Phf24 G A 4: 42,938,316 V226I probably benign Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ptprf T C 4: 118,211,432 D1713G probably damaging Het
Rbp3 G T 14: 33,954,112 V6F probably benign Het
Slc1a6 T A 10: 78,789,081 S107T probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Tgfbi T C 13: 56,609,734 Y30H probably damaging Het
Tmem217 A T 17: 29,526,558 V66D probably damaging Het
Tnn C A 1: 160,107,055 D1263Y probably damaging Het
Ylpm1 T C 12: 85,029,371 F499L probably damaging Het
Other mutations in Sac3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0494:Sac3d1 UTSW 19 6118294 missense probably damaging 0.99
R1555:Sac3d1 UTSW 19 6118405 missense probably damaging 0.99
R4642:Sac3d1 UTSW 19 6116404 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAACGCACGGTGGCTAAGAG -3'
(R):5'- ATGGGAGGCGTTTCTAAAGGC -3'

Sequencing Primer
(F):5'- TGTACTCCTTCACTGTGCGCTTG -3'
(R):5'- TTTCTAAAGGCCGCGGGAG -3'
Posted On2015-02-05