Incidental Mutation 'R3110:Adam15'
List |< first << previous [record 55 of 1871] next >> last >|
ID263808
Institutional Source Beutler Lab
Gene Symbol Adam15
Ensembl Gene ENSMUSG00000028041
Gene Namea disintegrin and metallopeptidase domain 15 (metargidin)
SynonymsMDC15, metargidin
MMRRC Submission 040584-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R3110 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89338542-89349996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 89347457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 99 (V99L)
Ref Sequence ENSEMBL: ENSMUSP00000139147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029676] [ENSMUST00000070820] [ENSMUST00000074582] [ENSMUST00000107446] [ENSMUST00000107448] [ENSMUST00000184651]
Predicted Effect probably benign
Transcript: ENSMUST00000029676
AA Change: V99L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029676
Gene: ENSMUSG00000028041
AA Change: V99L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 158 1.2e-14 PFAM
Pfam:Reprolysin_3 208 360 1e-12 PFAM
Pfam:Reprolysin_5 212 394 1.5e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 416 1.6e-54 PFAM
Pfam:Reprolysin_2 257 405 9.9e-12 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070820
SMART Domains Protein: ENSMUSP00000065502
Gene: ENSMUSG00000042672

DomainStartEndE-ValueType
coiled coil region 18 44 N/A INTRINSIC
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 108 125 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
Pfam:DC_STAMP 431 621 1.5e-55 PFAM
Blast:RING 672 710 3e-17 BLAST
SCOP:d1ldjb_ 672 710 2e-3 SMART
low complexity region 717 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074582
AA Change: V99L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074167
Gene: ENSMUSG00000028041
AA Change: V99L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.6e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 2.9e-8 PFAM
Pfam:Reprolysin 214 415 4.2e-56 PFAM
Pfam:Reprolysin_3 238 360 1.7e-14 PFAM
Pfam:Reprolysin_2 254 405 1.1e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 760 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107446
AA Change: V99L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103070
Gene: ENSMUSG00000028041
AA Change: V99L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 9.9e-22 PFAM
Pfam:Reprolysin_3 209 360 5.9e-15 PFAM
Pfam:Reprolysin_5 212 394 5e-16 PFAM
Pfam:Reprolysin_4 213 410 1e-8 PFAM
Pfam:Reprolysin 214 415 1.4e-56 PFAM
Pfam:Reprolysin_2 253 405 4e-11 PFAM
low complexity region 416 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107448
AA Change: V99L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103072
Gene: ENSMUSG00000028041
AA Change: V99L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.7e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 3e-8 PFAM
Pfam:Reprolysin 214 415 4.4e-56 PFAM
Pfam:Reprolysin_3 238 360 1.8e-14 PFAM
Pfam:Reprolysin_2 254 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 783 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180791
Predicted Effect probably benign
Transcript: ENSMUST00000184651
AA Change: V99L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139147
Gene: ENSMUSG00000028041
AA Change: V99L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.9e-21 PFAM
Pfam:Reprolysin_5 212 394 1.7e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 415 4.6e-56 PFAM
Pfam:Reprolysin_3 238 360 1.9e-14 PFAM
Pfam:Reprolysin_2 255 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is prominently expressed in vascular cells, the endocardium, hypertrophic cells in developing bone, and specific areas of hippocampus and cerebellum. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein have increased bone mass resulting from osteoblast proliferation, and exhibit reduced neovascularization in a mouse model for retinopathy. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice develop normally and exhibit normal angiogenesis, but show a resistance to pathological neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Ebf1 T A 11: 44,643,398 probably benign Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gm9932 A T 5: 100,198,935 unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Jmjd1c T A 10: 67,240,084 probably benign Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Adam15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Adam15 APN 3 89344138 missense probably benign 0.03
IGL01994:Adam15 APN 3 89341505 splice site probably benign
IGL02184:Adam15 APN 3 89345934 splice site probably benign
IGL02501:Adam15 APN 3 89340462 missense possibly damaging 0.82
IGL02821:Adam15 APN 3 89345356 missense probably damaging 1.00
IGL02933:Adam15 APN 3 89343483 missense possibly damaging 0.91
IGL03078:Adam15 APN 3 89345937 splice site probably benign
IGL03185:Adam15 APN 3 89347905 missense probably benign 0.41
R0559:Adam15 UTSW 3 89343778 missense probably damaging 1.00
R1530:Adam15 UTSW 3 89349830 missense probably damaging 0.99
R1670:Adam15 UTSW 3 89348510 splice site probably benign
R1909:Adam15 UTSW 3 89345330 missense probably benign 0.19
R3112:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3897:Adam15 UTSW 3 89346938 missense probably benign 0.00
R4058:Adam15 UTSW 3 89347055 missense possibly damaging 0.94
R4573:Adam15 UTSW 3 89345986 missense probably damaging 1.00
R5267:Adam15 UTSW 3 89349899 utr 5 prime probably benign
R5364:Adam15 UTSW 3 89345595 missense probably damaging 1.00
R5801:Adam15 UTSW 3 89342361 missense probably damaging 1.00
R5813:Adam15 UTSW 3 89345828 missense probably benign 0.12
R5964:Adam15 UTSW 3 89343567 nonsense probably null
R6218:Adam15 UTSW 3 89343883 missense probably benign 0.00
R6564:Adam15 UTSW 3 89347212 missense possibly damaging 0.56
R6579:Adam15 UTSW 3 89345629 missense probably damaging 1.00
R6834:Adam15 UTSW 3 89340083 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACCCTAGAGTCCAGCTTGC -3'
(R):5'- CGCGAATAATTACTGGGAGGTG -3'

Sequencing Primer
(F):5'- CCAGCAAGGGCAGGCAG -3'
(R):5'- AACTTGCCTGAGTTCGTACAG -3'
Posted On2015-02-05