Incidental Mutation 'R3113:Galnt12'
ID263870
Institutional Source Beutler Lab
Gene Symbol Galnt12
Ensembl Gene ENSMUSG00000039774
Gene Namepolypeptide N-acetylgalactosaminyltransferase 12
Synonyms
MMRRC Submission 040586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3113 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location47091909-47123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47108415 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 184 (N184S)
Ref Sequence ENSEMBL: ENSMUSP00000045721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045041] [ENSMUST00000107744]
Predicted Effect probably benign
Transcript: ENSMUST00000045041
AA Change: N184S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045721
Gene: ENSMUSG00000039774
AA Change: N184S

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 131 375 3.4e-10 PFAM
Pfam:Glycos_transf_2 134 317 1.4e-35 PFAM
Pfam:Glyco_tranf_2_2 134 360 6.6e-8 PFAM
Pfam:Glyco_transf_7C 290 363 3e-9 PFAM
RICIN 440 572 8.09e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107744
SMART Domains Protein: ENSMUSP00000103373
Gene: ENSMUSG00000039774

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 5 71 7.5e-9 PFAM
RICIN 148 280 8.09e-18 SMART
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik G T 7: 139,975,965 probably benign Het
9330159F19Rik T A 10: 29,224,376 Y248* probably null Het
Acta2 T C 19: 34,243,352 I319V probably benign Het
Alox15 A T 11: 70,344,877 N585K probably benign Het
Ank T A 15: 27,571,614 I324N probably damaging Het
Ank1 A G 8: 23,084,797 N99D probably damaging Het
As3mt T C 19: 46,715,278 probably benign Het
Atg4b C T 1: 93,775,704 probably benign Het
Atp2a1 A T 7: 126,448,369 V705D probably damaging Het
Bves T C 10: 45,343,052 V82A probably benign Het
Cad C A 5: 31,074,137 H7Q possibly damaging Het
Carmil1 A G 13: 24,069,757 V387A probably benign Het
Csnk2a1 T A 2: 152,263,214 F181Y probably damaging Het
Cwc22 A T 2: 77,924,479 probably benign Het
Ddx18 A G 1: 121,566,148 S36P possibly damaging Het
Dnaic2 T A 11: 114,751,930 probably null Het
Ehbp1l1 A T 19: 5,718,980 M765K probably benign Het
Fitm2 T C 2: 163,469,591 Y234C probably damaging Het
Flrt3 T C 2: 140,661,534 E58G probably benign Het
Foxs1 A G 2: 152,932,236 V299A probably benign Het
Gata6 T C 18: 11,063,124 L464P probably damaging Het
Gm17332 T C 11: 31,182,384 T27A possibly damaging Het
Ifna11 A C 4: 88,819,983 M9L probably benign Het
Ldb3 T A 14: 34,529,461 *623L probably null Het
Lrrc27 A G 7: 139,218,307 D106G probably damaging Het
Ly6f A G 15: 75,271,728 N95D probably benign Het
Lyst A G 13: 13,669,927 I1901V probably benign Het
Mboat2 A G 12: 24,882,719 Y70C probably damaging Het
Mroh1 T A 15: 76,408,536 probably benign Het
Muc5b A G 7: 141,846,134 H448R unknown Het
Mut G A 17: 40,958,356 G610D probably damaging Het
Myh2 A G 11: 67,185,186 N733S probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nlrp1a A T 11: 71,123,665 I253N probably damaging Het
Ocrl A G X: 47,933,427 E258G probably benign Het
Olfr263 T A 13: 21,133,129 M118K probably damaging Het
Olfr791 A T 10: 129,527,143 R305S probably benign Het
Pak1 C A 7: 97,866,114 S115* probably null Het
Pilrb1 C T 5: 137,854,933 V203I possibly damaging Het
Ppfia2 T A 10: 106,906,395 Y1016* probably null Het
Prmt3 C A 7: 49,782,012 P121Q probably damaging Het
Rhox6 T A X: 37,827,630 I116N possibly damaging Het
Saxo2 A C 7: 82,643,741 F49L probably benign Het
Scn2a A C 2: 65,748,785 D1488A possibly damaging Het
Scn5a T A 9: 119,485,672 D1989V probably damaging Het
Sec31b C A 19: 44,518,185 E905* probably null Het
Secisbp2l A T 2: 125,750,286 F672I probably damaging Het
Slc22a23 C T 13: 34,183,075 G650E probably damaging Het
Smu1 A G 4: 40,748,658 F211L probably benign Het
Tab1 C T 15: 80,148,260 L23F probably benign Het
Thsd7b G A 1: 130,049,862 C1078Y probably benign Het
Ttn A T 2: 76,814,198 Y13071N probably damaging Het
Usp17ld A G 7: 103,250,663 V354A probably benign Het
Usp31 A G 7: 121,679,513 S210P probably damaging Het
Wdr12 T C 1: 60,087,062 D198G probably benign Het
Wrap53 A G 11: 69,563,318 V298A probably benign Het
Xirp2 A G 2: 67,510,147 I911V probably benign Het
Zcchc2 T C 1: 105,991,022 M78T unknown Het
Other mutations in Galnt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Galnt12 APN 4 47112315 splice site probably benign
IGL02188:Galnt12 APN 4 47122521 missense probably damaging 1.00
IGL02217:Galnt12 APN 4 47113832 missense probably damaging 1.00
IGL02388:Galnt12 APN 4 47117941 missense probably damaging 1.00
IGL02550:Galnt12 APN 4 47104126 missense possibly damaging 0.47
IGL03062:Galnt12 APN 4 47122566 missense possibly damaging 0.80
R0508:Galnt12 UTSW 4 47104255 missense probably damaging 1.00
R1513:Galnt12 UTSW 4 47117956 missense probably damaging 1.00
R1634:Galnt12 UTSW 4 47108585 splice site probably null
R2072:Galnt12 UTSW 4 47108477 nonsense probably null
R2297:Galnt12 UTSW 4 47113834 missense probably damaging 1.00
R3157:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3158:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3159:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3725:Galnt12 UTSW 4 47104140 missense probably damaging 1.00
R4284:Galnt12 UTSW 4 47104231 missense probably damaging 1.00
R4691:Galnt12 UTSW 4 47104143 missense probably damaging 1.00
R5134:Galnt12 UTSW 4 47113818 missense probably damaging 1.00
R5408:Galnt12 UTSW 4 47104169 missense probably damaging 1.00
R5657:Galnt12 UTSW 4 47104150 missense possibly damaging 0.95
R6074:Galnt12 UTSW 4 47112405 missense probably damaging 1.00
R6406:Galnt12 UTSW 4 47122534 missense probably benign 0.00
R6721:Galnt12 UTSW 4 47122529 nonsense probably null
R7287:Galnt12 UTSW 4 47108525 missense probably damaging 1.00
R7407:Galnt12 UTSW 4 47120362 missense probably damaging 1.00
R7512:Galnt12 UTSW 4 47108406 missense not run
X0025:Galnt12 UTSW 4 47104166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCATAAGTCAACCTCTGAAG -3'
(R):5'- GTCTCACACACCTCTGCAGC -3'

Sequencing Primer
(F):5'- GCACCTATCTGATGGTTCACAATGG -3'
(R):5'- TAGGAAGGTCAGCACTTC -3'
Posted On2015-02-05