Incidental Mutation 'R3113:Pak1'
ID263876
Institutional Source Beutler Lab
Gene Symbol Pak1
Ensembl Gene ENSMUSG00000030774
Gene Namep21 (RAC1) activated kinase 1
SynonymsPaka, PAK-1
MMRRC Submission 040586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3113 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97788541-97912381 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 97866114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 115 (S115*)
Ref Sequence ENSEMBL: ENSMUSP00000146055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033040] [ENSMUST00000156637] [ENSMUST00000206351] [ENSMUST00000206984]
Predicted Effect probably null
Transcript: ENSMUST00000033040
AA Change: S115*
SMART Domains Protein: ENSMUSP00000033040
Gene: ENSMUSG00000030774
AA Change: S115*

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
low complexity region 168 191 N/A INTRINSIC
S_TKc 269 520 7.19e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156637
AA Change: S115*
SMART Domains Protein: ENSMUSP00000138684
Gene: ENSMUSG00000030774
AA Change: S115*

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000206351
AA Change: S115*
Predicted Effect probably null
Transcript: ENSMUST00000206984
AA Change: S115*
Meta Mutation Damage Score 0.61 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display defects in allergen-induced mast cell migration and degranulation. Mice homozygous for a different knock-out allele exhibit reduced long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik G T 7: 139,975,965 probably benign Het
9330159F19Rik T A 10: 29,224,376 Y248* probably null Het
Acta2 T C 19: 34,243,352 I319V probably benign Het
Alox15 A T 11: 70,344,877 N585K probably benign Het
Ank T A 15: 27,571,614 I324N probably damaging Het
Ank1 A G 8: 23,084,797 N99D probably damaging Het
As3mt T C 19: 46,715,278 probably benign Het
Atg4b C T 1: 93,775,704 probably benign Het
Atp2a1 A T 7: 126,448,369 V705D probably damaging Het
Bves T C 10: 45,343,052 V82A probably benign Het
Cad C A 5: 31,074,137 H7Q possibly damaging Het
Carmil1 A G 13: 24,069,757 V387A probably benign Het
Csnk2a1 T A 2: 152,263,214 F181Y probably damaging Het
Cwc22 A T 2: 77,924,479 probably benign Het
Ddx18 A G 1: 121,566,148 S36P possibly damaging Het
Dnaic2 T A 11: 114,751,930 probably null Het
Ehbp1l1 A T 19: 5,718,980 M765K probably benign Het
Fitm2 T C 2: 163,469,591 Y234C probably damaging Het
Flrt3 T C 2: 140,661,534 E58G probably benign Het
Foxs1 A G 2: 152,932,236 V299A probably benign Het
Galnt12 A G 4: 47,108,415 N184S probably benign Het
Gata6 T C 18: 11,063,124 L464P probably damaging Het
Gm17332 T C 11: 31,182,384 T27A possibly damaging Het
Ifna11 A C 4: 88,819,983 M9L probably benign Het
Ldb3 T A 14: 34,529,461 *623L probably null Het
Lrrc27 A G 7: 139,218,307 D106G probably damaging Het
Ly6f A G 15: 75,271,728 N95D probably benign Het
Lyst A G 13: 13,669,927 I1901V probably benign Het
Mboat2 A G 12: 24,882,719 Y70C probably damaging Het
Mroh1 T A 15: 76,408,536 probably benign Het
Muc5b A G 7: 141,846,134 H448R unknown Het
Mut G A 17: 40,958,356 G610D probably damaging Het
Myh2 A G 11: 67,185,186 N733S probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Nlrp1a A T 11: 71,123,665 I253N probably damaging Het
Ocrl A G X: 47,933,427 E258G probably benign Het
Olfr263 T A 13: 21,133,129 M118K probably damaging Het
Olfr791 A T 10: 129,527,143 R305S probably benign Het
Pilrb1 C T 5: 137,854,933 V203I possibly damaging Het
Ppfia2 T A 10: 106,906,395 Y1016* probably null Het
Prmt3 C A 7: 49,782,012 P121Q probably damaging Het
Rhox6 T A X: 37,827,630 I116N possibly damaging Het
Saxo2 A C 7: 82,643,741 F49L probably benign Het
Scn2a A C 2: 65,748,785 D1488A possibly damaging Het
Scn5a T A 9: 119,485,672 D1989V probably damaging Het
Sec31b C A 19: 44,518,185 E905* probably null Het
Secisbp2l A T 2: 125,750,286 F672I probably damaging Het
Slc22a23 C T 13: 34,183,075 G650E probably damaging Het
Smu1 A G 4: 40,748,658 F211L probably benign Het
Tab1 C T 15: 80,148,260 L23F probably benign Het
Thsd7b G A 1: 130,049,862 C1078Y probably benign Het
Ttn A T 2: 76,814,198 Y13071N probably damaging Het
Usp17ld A G 7: 103,250,663 V354A probably benign Het
Usp31 A G 7: 121,679,513 S210P probably damaging Het
Wdr12 T C 1: 60,087,062 D198G probably benign Het
Wrap53 A G 11: 69,563,318 V298A probably benign Het
Xirp2 A G 2: 67,510,147 I911V probably benign Het
Zcchc2 T C 1: 105,991,022 M78T unknown Het
Other mutations in Pak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Pak1 APN 7 97854568 missense probably benign 0.03
IGL01676:Pak1 APN 7 97883531 missense probably benign 0.00
IGL02058:Pak1 APN 7 97911115 missense probably damaging 1.00
IGL02557:Pak1 APN 7 97871587 missense probably benign 0.08
IGL02678:Pak1 APN 7 97894002 missense probably damaging 0.99
R1739:Pak1 UTSW 7 97904695 missense probably damaging 1.00
R1874:Pak1 UTSW 7 97871580 missense probably benign 0.23
R2057:Pak1 UTSW 7 97907797 splice site probably null
R2363:Pak1 UTSW 7 97886314 missense probably benign 0.01
R2420:Pak1 UTSW 7 97854479 missense probably benign 0.02
R2880:Pak1 UTSW 7 97904811 missense probably damaging 1.00
R3722:Pak1 UTSW 7 97854497 missense probably damaging 1.00
R4363:Pak1 UTSW 7 97883586 missense possibly damaging 0.49
R6021:Pak1 UTSW 7 97854463 missense probably damaging 1.00
R6459:Pak1 UTSW 7 97907881 missense probably benign 0.04
R6820:Pak1 UTSW 7 97886379 missense probably benign
R7336:Pak1 UTSW 7 97888972 missense probably benign 0.13
X0027:Pak1 UTSW 7 97904752 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGACCTCTGAAGGAAGAC -3'
(R):5'- ATCTTAGCGACCGTGCCATC -3'

Sequencing Primer
(F):5'- CCTCTGAAGGAAGACACATAAAAG -3'
(R):5'- ACCGTGCCATCACACTGG -3'
Posted On2015-02-05