Mutagenetix > Incidental Mutations

Incidental Mutation 'R3114:Cnot1'

263932

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040587-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95744278 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1314 (E1314G)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: E1309G

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: E1309G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083155

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098473
AA Change: E1314G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: E1314G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: E1307G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

unknown
Transcript: ENSMUST00000211973
AA Change: E781G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213006
AA Change: E1314G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.164

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atf7	C	T	15: 102,534,423	S417N	probably benign	Het
Cdt1	C	T	8: 122,570,482	Q305*	probably null	Het
Cfap65	T	A	1: 74,927,132	K345N	probably damaging	Het
Chrna3	C	T	9: 55,016,050	C158Y	probably damaging	Het
Col11a2	T	G	17: 34,046,468	V276G	possibly damaging	Het
Dnah8	A	G	17: 30,833,568	S4346G	probably benign	Het
Dnhd1	T	C	7: 105,696,565		probably null	Het
Espl1	T	A	15: 102,323,204	F1945Y	possibly damaging	Het
Fzd5	A	G	1: 64,735,580	F341L	probably benign	Het
Gm1587	T	G	14: 77,798,832	E11D	unknown	Het
Hist1h3c	C	A	13: 23,745,307	R64L	probably benign	Het
Ighv5-1	A	G	12: 113,574,224		probably benign	Het
Klhl3	A	G	13: 58,051,027		probably null	Het
Klhl33	A	T	14: 50,891,515	D752E	possibly damaging	Het
Krt24	T	A	11: 99,282,436	T298S	possibly damaging	Het
March1	A	C	8: 66,387,381	H272P	probably benign	Het
Mei1	C	T	15: 82,124,959	A835V	probably benign	Het
Mier3	T	A	13: 111,706,648	I178N	probably damaging	Het
Mlxipl	A	G	5: 135,133,662		probably benign	Het
Mob3a	A	T	10: 80,691,302	V63E	probably damaging	Het
Nos3	C	T	5: 24,372,631		probably benign	Het
Olfr1239	T	A	2: 89,418,413		probably null	Het
Pcdha11	T	A	18: 37,011,807	I317K	probably damaging	Het
Pcdha4	T	C	18: 36,953,550	V262A	probably benign	Het
Pde4d	T	A	13: 109,948,258	M519K	probably damaging	Het
Pds5a	A	G	5: 65,618,985	S89P	probably damaging	Het
Ptar1	T	A	19: 23,718,095	C309S	probably benign	Het
Rint1	A	G	5: 23,819,420	N682S	probably benign	Het
Rnmt	A	G	18: 68,314,008	E321G	probably benign	Het
Serpinb8	A	G	1: 107,607,293	I365V	probably benign	Het
Sik1	T	C	17: 31,848,132	T505A	probably benign	Het
Slfn10-ps	T	A	11: 83,029,129		noncoding transcript	Het
Sspn	A	T	6: 145,934,369	I66F	possibly damaging	Het
Tepp	T	C	8: 95,313,181		probably null	Het
Tldc1	G	A	8: 119,768,317	A234V	probably benign	Het
Tsc22d1	T	C	14: 76,417,337	S337P	probably damaging	Het
Wdfy4	A	G	14: 33,089,903	S1715P	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
X0050:Cnot1	UTSW	8	95743098	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTAGTAAGCCTATCCTTAGATGC -3'
(R):5'- AGTGGTCATTGCACCAGTGG -3'

Sequencing Primer
(F):5'- CTGCTCACACTTGATAATCAGATGGC -3'
(R):5'- CATTGCACCAGTGGATTGAATTG -3'

Posted On

2015-02-05