Mutagenetix > Incidental Mutation

Incidental Mutation 'R3114:Cnot1'

263932

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040587-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96446079-96534092 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96470906 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1314 (E1314G)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: E1309G

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: E1309G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083155

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098473
AA Change: E1314G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: E1314G

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: E1307G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

unknown
Transcript: ENSMUST00000211973
AA Change: E781G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212195

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213006
AA Change: E1314G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.0612

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atf7	C	T	15: 102,442,858 (GRCm39)	S417N	probably benign	Het
Cdt1	C	T	8: 123,297,221 (GRCm39)	Q305*	probably null	Het
Cfap65	T	A	1: 74,966,291 (GRCm39)	K345N	probably damaging	Het
Chrna3	C	T	9: 54,923,334 (GRCm39)	C158Y	probably damaging	Het
Col11a2	T	G	17: 34,265,442 (GRCm39)	V276G	possibly damaging	Het
Dnah8	A	G	17: 31,052,542 (GRCm39)	S4346G	probably benign	Het
Dnhd1	T	C	7: 105,345,772 (GRCm39)		probably null	Het
Espl1	T	A	15: 102,231,639 (GRCm39)	F1945Y	possibly damaging	Het
Fzd5	A	G	1: 64,774,739 (GRCm39)	F341L	probably benign	Het
Gm1587	T	G	14: 78,036,272 (GRCm39)	E11D	unknown	Het
H3c3	C	A	13: 23,929,290 (GRCm39)	R64L	probably benign	Het
Ighv5-1	A	G	12: 113,537,844 (GRCm39)		probably benign	Het
Klhl3	A	G	13: 58,198,841 (GRCm39)		probably null	Het
Klhl33	A	T	14: 51,128,972 (GRCm39)	D752E	possibly damaging	Het
Krt24	T	A	11: 99,173,262 (GRCm39)	T298S	possibly damaging	Het
Marchf1	A	C	8: 66,840,033 (GRCm39)	H272P	probably benign	Het
Meak7	G	A	8: 120,495,056 (GRCm39)	A234V	probably benign	Het
Mei1	C	T	15: 82,009,160 (GRCm39)	A835V	probably benign	Het
Mier3	T	A	13: 111,843,182 (GRCm39)	I178N	probably damaging	Het
Mlxipl	A	G	5: 135,162,516 (GRCm39)		probably benign	Het
Mob3a	A	T	10: 80,527,136 (GRCm39)	V63E	probably damaging	Het
Nos3	C	T	5: 24,577,629 (GRCm39)		probably benign	Het
Or4a2	T	A	2: 89,248,757 (GRCm39)		probably null	Het
Pcdha11	T	A	18: 37,144,860 (GRCm39)	I317K	probably damaging	Het
Pcdha4	T	C	18: 37,086,603 (GRCm39)	V262A	probably benign	Het
Pde4d	T	A	13: 110,084,792 (GRCm39)	M519K	probably damaging	Het
Pds5a	A	G	5: 65,776,328 (GRCm39)	S89P	probably damaging	Het
Ptar1	T	A	19: 23,695,459 (GRCm39)	C309S	probably benign	Het
Rint1	A	G	5: 24,024,418 (GRCm39)	N682S	probably benign	Het
Rnmt	A	G	18: 68,447,079 (GRCm39)	E321G	probably benign	Het
Serpinb8	A	G	1: 107,535,023 (GRCm39)	I365V	probably benign	Het
Sik1	T	C	17: 32,067,106 (GRCm39)	T505A	probably benign	Het
Slfn10-ps	T	A	11: 82,919,955 (GRCm39)		noncoding transcript	Het
Spmip8	T	C	8: 96,039,809 (GRCm39)		probably null	Het
Sspn	A	T	6: 145,880,095 (GRCm39)	I66F	possibly damaging	Het
Tsc22d1	T	C	14: 76,654,777 (GRCm39)	S337P	probably damaging	Het
Wdfy4	A	G	14: 32,811,860 (GRCm39)	S1715P	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	96,452,707 (GRCm39)	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	96,487,165 (GRCm39)	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	96,467,637 (GRCm39)	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	96,455,346 (GRCm39)	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	96,482,761 (GRCm39)	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	96,500,113 (GRCm39)	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	96,471,645 (GRCm39)	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	96,481,706 (GRCm39)	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	96,496,243 (GRCm39)	intron	probably benign
IGL03174:Cnot1	APN	8	96,487,983 (GRCm39)	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	96,462,308 (GRCm39)	splice site	probably benign
IGL03371:Cnot1	APN	8	96,501,344 (GRCm39)	missense	possibly damaging	0.85
Affiliate	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
Barge	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
Byproduct	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
Chairman	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
cohort	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
Director	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
kowloon	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
Quorum	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
tugboat	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
Xiao	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB003:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB011:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB013:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	96,489,772 (GRCm39)	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	96,498,628 (GRCm39)	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	96,475,483 (GRCm39)	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	96,486,836 (GRCm39)	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	96,455,295 (GRCm39)	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	96,469,841 (GRCm39)	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	96,496,460 (GRCm39)	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	96,474,904 (GRCm39)	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	96,451,205 (GRCm39)	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	96,468,572 (GRCm39)	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	96,451,221 (GRCm39)	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	96,466,469 (GRCm39)	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	96,501,986 (GRCm39)	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	96,452,781 (GRCm39)	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	96,488,054 (GRCm39)	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	96,475,690 (GRCm39)	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	96,501,280 (GRCm39)	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3115:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	96,466,476 (GRCm39)	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	96,496,407 (GRCm39)	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	96,501,310 (GRCm39)	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	96,459,859 (GRCm39)	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	96,489,695 (GRCm39)	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	96,448,254 (GRCm39)	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	96,467,636 (GRCm39)	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	96,479,396 (GRCm39)	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	96,486,815 (GRCm39)	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	96,483,983 (GRCm39)	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	96,470,924 (GRCm39)	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	96,460,775 (GRCm39)	nonsense	probably null
R5956:Cnot1	UTSW	8	96,481,606 (GRCm39)	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	96,515,293 (GRCm39)	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	96,475,522 (GRCm39)	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	96,468,549 (GRCm39)	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	96,499,895 (GRCm39)	intron	probably benign
R6882:Cnot1	UTSW	8	96,447,054 (GRCm39)	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	96,451,160 (GRCm39)	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	96,459,787 (GRCm39)	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	96,454,276 (GRCm39)	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	96,478,447 (GRCm39)	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	96,497,260 (GRCm39)	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	96,486,726 (GRCm39)	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	96,478,406 (GRCm39)	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7914:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7924:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7926:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7981:Cnot1	UTSW	8	96,489,797 (GRCm39)	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	96,479,380 (GRCm39)	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	96,487,979 (GRCm39)	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	96,478,389 (GRCm39)	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	96,473,649 (GRCm39)	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	96,496,472 (GRCm39)	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	96,460,952 (GRCm39)	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	96,462,907 (GRCm39)	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	96,491,695 (GRCm39)	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	96,475,660 (GRCm39)	missense	probably benign
R9179:Cnot1	UTSW	8	96,500,054 (GRCm39)	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	96,497,227 (GRCm39)	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	96,497,338 (GRCm39)	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	96,482,854 (GRCm39)	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	96,482,835 (GRCm39)	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	96,455,874 (GRCm39)	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	96,488,019 (GRCm39)	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	96,496,209 (GRCm39)	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	96,455,772 (GRCm39)	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	96,469,726 (GRCm39)	splice site	probably null
Z1176:Cnot1	UTSW	8	96,474,905 (GRCm39)	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ATCTAGTAAGCCTATCCTTAGATGC -3'
(R):5'- AGTGGTCATTGCACCAGTGG -3'

Sequencing Primer
(F):5'- CTGCTCACACTTGATAATCAGATGGC -3'
(R):5'- CATTGCACCAGTGGATTGAATTG -3'

Posted On

2015-02-05