Incidental Mutation 'R3115:Mybph'
ID263958
Institutional Source Beutler Lab
Gene Symbol Mybph
Ensembl Gene ENSMUSG00000042451
Gene Namemyosin binding protein H
Synonyms
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3115 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134193448-134201232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134194738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 174 (I174V)
Ref Sequence ENSEMBL: ENSMUSP00000141104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038445] [ENSMUST00000082060] [ENSMUST00000086465] [ENSMUST00000153856] [ENSMUST00000156873] [ENSMUST00000169927] [ENSMUST00000191577]
Predicted Effect probably benign
Transcript: ENSMUST00000038445
AA Change: I174V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451
AA Change: I174V

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082060
SMART Domains Protein: ENSMUSP00000080717
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Glyco_18 30 366 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086465
SMART Domains Protein: ENSMUSP00000083656
Gene: ENSMUSG00000042429

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134812
Predicted Effect probably benign
Transcript: ENSMUST00000153856
SMART Domains Protein: ENSMUSP00000117117
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 358 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156873
SMART Domains Protein: ENSMUSP00000119205
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Glyco_18 20 356 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169927
SMART Domains Protein: ENSMUSP00000132105
Gene: ENSMUSG00000042429

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191577
AA Change: I174V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451
AA Change: I174V

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Mybph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Mybph APN 1 134193925 missense probably benign 0.02
IGL02312:Mybph APN 1 134197450 missense probably damaging 0.99
R0055:Mybph UTSW 1 134193852 missense probably damaging 0.99
R0055:Mybph UTSW 1 134193852 missense probably damaging 0.99
R0346:Mybph UTSW 1 134197754 missense probably damaging 1.00
R0669:Mybph UTSW 1 134197343 splice site probably null
R0765:Mybph UTSW 1 134197496 missense possibly damaging 0.78
R1349:Mybph UTSW 1 134193615 missense probably benign 0.00
R1662:Mybph UTSW 1 134193636 missense probably benign 0.01
R1728:Mybph UTSW 1 134197480 missense probably benign 0.00
R1729:Mybph UTSW 1 134197480 missense probably benign 0.00
R1730:Mybph UTSW 1 134197480 missense probably benign 0.00
R1739:Mybph UTSW 1 134197480 missense probably benign 0.00
R1762:Mybph UTSW 1 134197480 missense probably benign 0.00
R1783:Mybph UTSW 1 134197480 missense probably benign 0.00
R1784:Mybph UTSW 1 134197480 missense probably benign 0.00
R1785:Mybph UTSW 1 134197480 missense probably benign 0.00
R1978:Mybph UTSW 1 134196996 missense probably benign 0.01
R2058:Mybph UTSW 1 134200119 missense probably damaging 1.00
R4841:Mybph UTSW 1 134198495 missense probably damaging 1.00
R4842:Mybph UTSW 1 134198495 missense probably damaging 1.00
R5208:Mybph UTSW 1 134193535 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAACAGCCAGACATTCTCCG -3'
(R):5'- CTGGACCATTTAGGGAGGTG -3'

Sequencing Primer
(F):5'- AGACATTCTCCGCTGCCC -3'
(R):5'- AGGTGGCGTCTTTGACCTCC -3'
Posted On2015-02-05