Mutagenetix > Incidental Mutation

Incidental Mutation 'R3115:Knl1'

263963

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

Casc5, 2310043D08Rik, 5730505K17Rik

MMRRC Submission

040588-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3115 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118877600-118935982 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 118900872 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 858 (L858M)

Ref Sequence

ENSEMBL: ENSMUSP00000097140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]

AlphaFold

Q66JQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000028799
AA Change: L858M

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: L858M

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028802
AA Change: L858M

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: L858M

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099542
AA Change: L858M

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: L858M

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153300

SMART Domains

Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	A	G	8: 87,266,653 (GRCm39)		probably null	Het
Abcc9	T	C	6: 142,634,755 (GRCm39)	T170A	probably benign	Het
Agbl2	T	C	2: 90,636,245 (GRCm39)	S594P	possibly damaging	Het
Aoc1l3	A	G	6: 48,964,331 (GRCm39)	Y113C	probably damaging	Het
Atf7	C	T	15: 102,442,858 (GRCm39)	S417N	probably benign	Het
Cacng7	T	C	7: 3,387,450 (GRCm39)	V111A	probably benign	Het
Chrm4	A	G	2: 91,757,705 (GRCm39)	T38A	probably benign	Het
Cnot1	T	C	8: 96,470,906 (GRCm39)	E1314G	possibly damaging	Het
Dcx	A	G	X: 142,706,105 (GRCm39)	Y229H	probably damaging	Het
Espl1	T	A	15: 102,231,639 (GRCm39)	F1945Y	possibly damaging	Het
Glul	T	C	1: 153,783,038 (GRCm39)	F204L	possibly damaging	Het
Grm2	A	G	9: 106,524,822 (GRCm39)	V631A	probably damaging	Het
Ifi205	T	A	1: 173,855,901 (GRCm39)	Y43F	possibly damaging	Het
Irs3	A	G	5: 137,642,118 (GRCm39)	L440P	probably benign	Het
Itpr1	A	G	6: 108,383,070 (GRCm39)	D1466G	possibly damaging	Het
Jarid2	T	C	13: 45,049,942 (GRCm39)	S257P	probably damaging	Het
Krt24	T	A	11: 99,173,262 (GRCm39)	T298S	possibly damaging	Het
Lrriq1	C	T	10: 103,006,294 (GRCm39)	R1277Q	probably benign	Het
Mgp	A	C	6: 136,849,683 (GRCm39)	Y92D	probably damaging	Het
Micu3	A	G	8: 40,835,208 (GRCm39)	H521R	probably benign	Het
Mier3	T	A	13: 111,843,182 (GRCm39)	I178N	probably damaging	Het
Moxd1	G	T	10: 24,177,429 (GRCm39)	E582*	probably null	Het
Mprip	T	A	11: 59,656,229 (GRCm39)		probably null	Het
Mybph	A	G	1: 134,122,476 (GRCm39)	I174V	probably benign	Het
Mynn	C	T	3: 30,661,959 (GRCm39)	T347M	probably damaging	Het
Nhsl1	A	T	10: 18,400,916 (GRCm39)	Q714L	probably damaging	Het
Nr1d2	A	T	14: 18,215,504 (GRCm38)		probably null	Het
Or10g3	T	C	14: 52,610,397 (GRCm39)	T38A	probably damaging	Het
Or2a5	T	C	6: 42,873,784 (GRCm39)	V133A	probably benign	Het
Or52h9	C	A	7: 104,202,295 (GRCm39)	H56Q	probably benign	Het
Or5p61	T	C	7: 107,759,029 (GRCm39)	E17G	probably benign	Het
Pcdha4	T	C	18: 37,086,603 (GRCm39)	V262A	probably benign	Het
Pde4d	T	A	13: 110,084,792 (GRCm39)	M519K	probably damaging	Het
Phactr2	C	A	10: 13,137,645 (GRCm39)	E166*	probably null	Het
Prdx4	C	T	X: 154,113,407 (GRCm39)	R167Q	probably damaging	Het
Prkdc	C	T	16: 15,482,222 (GRCm39)	L422F	probably benign	Het
Prph	T	A	15: 98,953,337 (GRCm39)	F84I	probably damaging	Het
Rnmt	A	G	18: 68,447,079 (GRCm39)	E321G	probably benign	Het
Serpinb13	A	T	1: 106,910,568 (GRCm39)	E64V	probably null	Het
Slc12a4	A	T	8: 106,686,091 (GRCm39)	S81T	probably damaging	Het
Slc47a1	A	G	11: 61,258,506 (GRCm39)	L179P	possibly damaging	Het
Sp140l2	C	G	1: 85,235,106 (GRCm39)		probably benign	Het
Spata31e5	A	C	1: 28,815,410 (GRCm39)	V874G	possibly damaging	Het
Sycp2l	C	A	13: 41,302,274 (GRCm39)	T456K	probably benign	Het
Tenm2	A	G	11: 35,914,193 (GRCm39)	L2447P	probably damaging	Het
Tll1	A	G	8: 64,506,900 (GRCm39)	C614R	probably damaging	Het
Usp5	T	C	6: 124,792,560 (GRCm39)	Y826C	probably damaging	Het
Vmn2r71	A	C	7: 85,272,866 (GRCm39)	D560A	probably damaging	Het
Wdr91	A	G	6: 34,882,522 (GRCm39)	L209P	probably damaging	Het
Zfp511	T	A	7: 139,616,504 (GRCm39)	D46E	probably benign	Het
Zfp81	C	T	17: 33,553,537 (GRCm39)	A426T	possibly damaging	Het
Zscan22	T	C	7: 12,641,217 (GRCm39)	I328T	probably benign	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	118,894,564 (GRCm39)	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	118,932,980 (GRCm39)	missense	probably benign	0.19
IGL00666:Knl1	APN	2	118,900,945 (GRCm39)	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	118,907,461 (GRCm39)	missense	probably benign	0.33
IGL01395:Knl1	APN	2	118,902,047 (GRCm39)	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	118,900,482 (GRCm39)	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	118,934,542 (GRCm39)	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	118,931,255 (GRCm39)	missense	probably benign	0.40
IGL02105:Knl1	APN	2	118,902,289 (GRCm39)	missense	probably benign
IGL02106:Knl1	APN	2	118,902,489 (GRCm39)	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	118,899,633 (GRCm39)	missense	probably benign	0.01
IGL02252:Knl1	APN	2	118,903,021 (GRCm39)	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	118,900,804 (GRCm39)	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	118,901,473 (GRCm39)	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	118,908,450 (GRCm39)	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	118,901,411 (GRCm39)	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	118,919,312 (GRCm39)	missense	probably benign	0.08
IGL03100:Knl1	APN	2	118,931,251 (GRCm39)	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	118,901,098 (GRCm39)	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	118,902,840 (GRCm39)	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	118,933,030 (GRCm39)	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0078:Knl1	UTSW	2	118,900,373 (GRCm39)	missense	probably benign	0.16
R0178:Knl1	UTSW	2	118,888,886 (GRCm39)	splice site	probably benign
R0295:Knl1	UTSW	2	118,919,320 (GRCm39)	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	118,934,542 (GRCm39)	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	118,898,869 (GRCm39)	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	118,927,916 (GRCm39)	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	118,919,382 (GRCm39)	splice site	probably benign
R0920:Knl1	UTSW	2	118,900,309 (GRCm39)	missense	probably benign	0.00
R1120:Knl1	UTSW	2	118,892,856 (GRCm39)	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	118,901,635 (GRCm39)	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	118,901,670 (GRCm39)	missense	probably benign	0.00
R1241:Knl1	UTSW	2	118,903,054 (GRCm39)	missense	probably benign	0.03
R1387:Knl1	UTSW	2	118,901,211 (GRCm39)	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	118,898,788 (GRCm39)	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	118,902,219 (GRCm39)	missense	probably benign	0.01
R1721:Knl1	UTSW	2	118,906,815 (GRCm39)	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	118,902,300 (GRCm39)	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	118,918,075 (GRCm39)	critical splice donor site	probably null
R2227:Knl1	UTSW	2	118,902,481 (GRCm39)	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	118,902,708 (GRCm39)	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	118,902,762 (GRCm39)	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	118,888,849 (GRCm39)	nonsense	probably null
R3122:Knl1	UTSW	2	118,899,425 (GRCm39)	missense	probably benign	0.32
R3431:Knl1	UTSW	2	118,892,843 (GRCm39)	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	118,933,060 (GRCm39)	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	118,890,080 (GRCm39)	missense	probably benign	0.00
R4600:Knl1	UTSW	2	118,901,025 (GRCm39)	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	118,899,618 (GRCm39)	nonsense	probably null
R4758:Knl1	UTSW	2	118,902,213 (GRCm39)	frame shift	probably null
R4762:Knl1	UTSW	2	118,902,417 (GRCm39)	missense	probably benign	0.01
R4869:Knl1	UTSW	2	118,902,832 (GRCm39)	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	118,911,994 (GRCm39)	missense	probably benign	0.22
R4935:Knl1	UTSW	2	118,899,438 (GRCm39)	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	118,900,512 (GRCm39)	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	118,899,657 (GRCm39)	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	118,900,176 (GRCm39)	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	118,900,736 (GRCm39)	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	118,901,464 (GRCm39)	missense	probably benign	0.01
R5493:Knl1	UTSW	2	118,899,211 (GRCm39)	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	118,900,833 (GRCm39)	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	118,912,031 (GRCm39)	nonsense	probably null
R5854:Knl1	UTSW	2	118,900,884 (GRCm39)	missense	probably benign	0.02
R5979:Knl1	UTSW	2	118,899,841 (GRCm39)	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	118,924,549 (GRCm39)	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	118,900,767 (GRCm39)	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	118,902,422 (GRCm39)	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	118,899,799 (GRCm39)	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	118,899,484 (GRCm39)	missense	probably benign	0.02
R6608:Knl1	UTSW	2	118,917,093 (GRCm39)	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	118,925,665 (GRCm39)	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	118,901,266 (GRCm39)	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	118,899,780 (GRCm39)	missense	probably benign	0.35
R7270:Knl1	UTSW	2	118,933,003 (GRCm39)	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	118,902,167 (GRCm39)	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	118,901,040 (GRCm39)	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	118,925,707 (GRCm39)	nonsense	probably null
R7408:Knl1	UTSW	2	118,901,073 (GRCm39)	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	118,918,027 (GRCm39)	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	118,901,179 (GRCm39)	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	118,896,460 (GRCm39)	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	118,924,487 (GRCm39)	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	118,925,614 (GRCm39)	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	118,902,037 (GRCm39)	missense	probably benign	0.13
R7847:Knl1	UTSW	2	118,901,457 (GRCm39)	missense	probably benign	0.02
R8423:Knl1	UTSW	2	118,900,513 (GRCm39)	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8727:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8995:Knl1	UTSW	2	118,902,990 (GRCm39)	missense	probably benign	0.11
R9023:Knl1	UTSW	2	118,900,761 (GRCm39)	missense	probably benign	0.27
R9100:Knl1	UTSW	2	118,899,469 (GRCm39)	missense	probably benign	0.02
R9102:Knl1	UTSW	2	118,917,973 (GRCm39)	missense	probably benign	0.22
R9303:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	118,931,224 (GRCm39)	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	118,899,979 (GRCm39)	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	118,887,782 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,907,425 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,899,994 (GRCm39)	missense	probably benign	0.02
R9671:Knl1	UTSW	2	118,901,089 (GRCm39)	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	118,900,381 (GRCm39)	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	118,899,910 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CACGTGGTCAGGTTGAAATGG -3'
(R):5'- TCTGAGTTTTGCCTGACAGAAG -3'

Sequencing Primer
(F):5'- GCCCAGTGATATAACTCCTGGTG -3'
(R):5'- TGCCTGACAGAAGTTCATTCAG -3'

Posted On

2015-02-05