Incidental Mutation 'R0324:Catsper1'
ID26399
Institutional Source Beutler Lab
Gene Symbol Catsper1
Ensembl Gene ENSMUSG00000038498
Gene Namecation channel, sperm associated 1
SynonymsKSper
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5335741-5344153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5336545 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 269 (S269C)
Ref Sequence ENSEMBL: ENSMUSP00000045430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043380]
Predicted Effect probably damaging
Transcript: ENSMUST00000043380
AA Change: S269C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045430
Gene: ENSMUSG00000038498
AA Change: S269C

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 128 141 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
low complexity region 308 321 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Pfam:Ion_trans 350 584 1.7e-34 PFAM
Pfam:PKD_channel 439 583 6.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit sperm with markedly decreased motility that are unable to fertilize ova and lack a calcium ion influx response to cyclic-AMP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Catsper1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Catsper1 APN 19 5337772 missense probably damaging 1.00
IGL01361:Catsper1 APN 19 5339479 missense probably damaging 1.00
IGL02413:Catsper1 APN 19 5336236 missense possibly damaging 0.46
IGL02560:Catsper1 APN 19 5336188 missense possibly damaging 0.93
IGL03335:Catsper1 APN 19 5336311 missense probably damaging 0.97
R0002:Catsper1 UTSW 19 5341523 splice site probably benign
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R1782:Catsper1 UTSW 19 5335909 missense probably benign 0.01
R2301:Catsper1 UTSW 19 5340398 missense probably benign 0.41
R3864:Catsper1 UTSW 19 5336176 missense possibly damaging 0.93
R4808:Catsper1 UTSW 19 5344136 missense possibly damaging 0.76
R4941:Catsper1 UTSW 19 5341438 missense possibly damaging 0.90
R4983:Catsper1 UTSW 19 5335963 missense probably benign 0.26
R5072:Catsper1 UTSW 19 5340046 unclassified probably null
R5077:Catsper1 UTSW 19 5335970 missense probably damaging 0.99
R5629:Catsper1 UTSW 19 5336137 missense probably benign 0.00
R6402:Catsper1 UTSW 19 5339496 missense probably damaging 1.00
R6875:Catsper1 UTSW 19 5343963 missense probably damaging 0.99
R7368:Catsper1 UTSW 19 5336663 missense unknown
R7510:Catsper1 UTSW 19 5339550 missense not run
Predicted Primers PCR Primer
(F):5'- AGTCGCCAGGAAAGACCTCATCTC -3'
(R):5'- GCGAATGGCTGATTGAATGCACAC -3'

Sequencing Primer
(F):5'- TGATCACCATCATGAGGGC -3'
(R):5'- CTTGCTGATGGCTGAAAAGC -3'
Posted On2013-04-16