Incidental Mutation 'R3115:Olfr1512'
ID263996
Institutional Source Beutler Lab
Gene Symbol Olfr1512
Ensembl Gene ENSMUSG00000094140
Gene Nameolfactory receptor 1512
SynonymsGA_x6K02T2RJGY-622120-623061, MOR223-5
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3115 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52371332-52379168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52372940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000149717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071221] [ENSMUST00000214980]
Predicted Effect probably damaging
Transcript: ENSMUST00000071221
AA Change: T38A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071208
Gene: ENSMUSG00000094140
AA Change: T38A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.1e-48 PFAM
Pfam:7tm_1 41 290 2.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200261
Predicted Effect probably damaging
Transcript: ENSMUST00000214980
AA Change: T38A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Olfr1512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1512 APN 14 52372510 missense probably damaging 1.00
IGL01375:Olfr1512 APN 14 52372408 missense probably damaging 0.99
IGL02343:Olfr1512 APN 14 52372477 missense probably damaging 1.00
R1443:Olfr1512 UTSW 14 52372951 missense probably damaging 1.00
R1902:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R1903:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R4752:Olfr1512 UTSW 14 52372307 missense probably damaging 1.00
R5345:Olfr1512 UTSW 14 52372268 nonsense probably null
R5689:Olfr1512 UTSW 14 52372757 missense possibly damaging 0.83
R6185:Olfr1512 UTSW 14 52372562 missense possibly damaging 0.91
R6287:Olfr1512 UTSW 14 52372291 missense probably damaging 1.00
R6757:Olfr1512 UTSW 14 52372715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAAACACTGGGAACTTCC -3'
(R):5'- CCACTTGCGCATCATCTATG -3'

Sequencing Primer
(F):5'- GGAACTTCCCAGAAAGTGGTAG -3'
(R):5'- ATGCTAACCCCTGCTTGTCTG -3'
Posted On2015-02-05