Mutagenetix > Incidental Mutation

Incidental Mutation 'R3115:Dcx'

264002

Institutional Source

Beutler Lab

Gene Symbol

Dcx

Ensembl Gene

ENSMUSG00000031285

Gene Name

doublecortin

Synonyms

lissencephaly, X-linked (doublecortin), Dbct

MMRRC Submission

040588-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R3115 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

142638838-142716307 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 142706105 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 229 (Y229H)

Ref Sequence

ENSEMBL: ENSMUSP00000084570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033642] [ENSMUST00000087313] [ENSMUST00000112851] [ENSMUST00000112856]

AlphaFold

O88809

Predicted Effect

probably damaging
Transcript: ENSMUST00000033642
AA Change: Y229H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033642
Gene: ENSMUSG00000031285
AA Change: Y229H

Domain	Start	End	E-Value	Type
DCX	48	139	3.09e-48	SMART
DCX	175	263	2.69e-39	SMART
low complexity region	349	365	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087313
AA Change: Y229H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084570
Gene: ENSMUSG00000031285
AA Change: Y229H

Domain	Start	End	E-Value	Type
DCX	48	139	3.09e-48	SMART
DCX	175	263	2.69e-39	SMART
low complexity region	349	365	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112851
AA Change: Y229H

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108472
Gene: ENSMUSG00000031285
AA Change: Y229H

Domain	Start	End	E-Value	Type
DCX	48	139	3.09e-48	SMART
DCX	175	263	2.69e-39	SMART
low complexity region	348	364	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112856
AA Change: Y229H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108477
Gene: ENSMUSG00000031285
AA Change: Y229H

Domain	Start	End	E-Value	Type
DCX	48	139	3.09e-48	SMART
DCX	175	263	2.69e-39	SMART
low complexity region	343	359	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125768

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139920

Meta Mutation Damage Score

0.5089

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. Studies in knockout mice lacking this gene and the LIS1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. Multiple transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Males hemizygous for a null allele are fertile but show branching and nucleokinesis defects in migrating interneurons. Males hemizygous for a reporter allele show severe postnatal lethality and variable fertility; both female and male mutants display hippocampal dyslamination and behavioral defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	A	G	8: 87,266,653 (GRCm39)		probably null	Het
Abcc9	T	C	6: 142,634,755 (GRCm39)	T170A	probably benign	Het
Agbl2	T	C	2: 90,636,245 (GRCm39)	S594P	possibly damaging	Het
Aoc1l3	A	G	6: 48,964,331 (GRCm39)	Y113C	probably damaging	Het
Atf7	C	T	15: 102,442,858 (GRCm39)	S417N	probably benign	Het
Cacng7	T	C	7: 3,387,450 (GRCm39)	V111A	probably benign	Het
Chrm4	A	G	2: 91,757,705 (GRCm39)	T38A	probably benign	Het
Cnot1	T	C	8: 96,470,906 (GRCm39)	E1314G	possibly damaging	Het
Espl1	T	A	15: 102,231,639 (GRCm39)	F1945Y	possibly damaging	Het
Glul	T	C	1: 153,783,038 (GRCm39)	F204L	possibly damaging	Het
Grm2	A	G	9: 106,524,822 (GRCm39)	V631A	probably damaging	Het
Ifi205	T	A	1: 173,855,901 (GRCm39)	Y43F	possibly damaging	Het
Irs3	A	G	5: 137,642,118 (GRCm39)	L440P	probably benign	Het
Itpr1	A	G	6: 108,383,070 (GRCm39)	D1466G	possibly damaging	Het
Jarid2	T	C	13: 45,049,942 (GRCm39)	S257P	probably damaging	Het
Knl1	C	A	2: 118,900,872 (GRCm39)	L858M	possibly damaging	Het
Krt24	T	A	11: 99,173,262 (GRCm39)	T298S	possibly damaging	Het
Lrriq1	C	T	10: 103,006,294 (GRCm39)	R1277Q	probably benign	Het
Mgp	A	C	6: 136,849,683 (GRCm39)	Y92D	probably damaging	Het
Micu3	A	G	8: 40,835,208 (GRCm39)	H521R	probably benign	Het
Mier3	T	A	13: 111,843,182 (GRCm39)	I178N	probably damaging	Het
Moxd1	G	T	10: 24,177,429 (GRCm39)	E582*	probably null	Het
Mprip	T	A	11: 59,656,229 (GRCm39)		probably null	Het
Mybph	A	G	1: 134,122,476 (GRCm39)	I174V	probably benign	Het
Mynn	C	T	3: 30,661,959 (GRCm39)	T347M	probably damaging	Het
Nhsl1	A	T	10: 18,400,916 (GRCm39)	Q714L	probably damaging	Het
Nr1d2	A	T	14: 18,215,504 (GRCm38)		probably null	Het
Or10g3	T	C	14: 52,610,397 (GRCm39)	T38A	probably damaging	Het
Or2a5	T	C	6: 42,873,784 (GRCm39)	V133A	probably benign	Het
Or52h9	C	A	7: 104,202,295 (GRCm39)	H56Q	probably benign	Het
Or5p61	T	C	7: 107,759,029 (GRCm39)	E17G	probably benign	Het
Pcdha4	T	C	18: 37,086,603 (GRCm39)	V262A	probably benign	Het
Pde4d	T	A	13: 110,084,792 (GRCm39)	M519K	probably damaging	Het
Phactr2	C	A	10: 13,137,645 (GRCm39)	E166*	probably null	Het
Prdx4	C	T	X: 154,113,407 (GRCm39)	R167Q	probably damaging	Het
Prkdc	C	T	16: 15,482,222 (GRCm39)	L422F	probably benign	Het
Prph	T	A	15: 98,953,337 (GRCm39)	F84I	probably damaging	Het
Rnmt	A	G	18: 68,447,079 (GRCm39)	E321G	probably benign	Het
Serpinb13	A	T	1: 106,910,568 (GRCm39)	E64V	probably null	Het
Slc12a4	A	T	8: 106,686,091 (GRCm39)	S81T	probably damaging	Het
Slc47a1	A	G	11: 61,258,506 (GRCm39)	L179P	possibly damaging	Het
Sp140l2	C	G	1: 85,235,106 (GRCm39)		probably benign	Het
Spata31e5	A	C	1: 28,815,410 (GRCm39)	V874G	possibly damaging	Het
Sycp2l	C	A	13: 41,302,274 (GRCm39)	T456K	probably benign	Het
Tenm2	A	G	11: 35,914,193 (GRCm39)	L2447P	probably damaging	Het
Tll1	A	G	8: 64,506,900 (GRCm39)	C614R	probably damaging	Het
Usp5	T	C	6: 124,792,560 (GRCm39)	Y826C	probably damaging	Het
Vmn2r71	A	C	7: 85,272,866 (GRCm39)	D560A	probably damaging	Het
Wdr91	A	G	6: 34,882,522 (GRCm39)	L209P	probably damaging	Het
Zfp511	T	A	7: 139,616,504 (GRCm39)	D46E	probably benign	Het
Zfp81	C	T	17: 33,553,537 (GRCm39)	A426T	possibly damaging	Het
Zscan22	T	C	7: 12,641,217 (GRCm39)	I328T	probably benign	Het

Other mutations in Dcx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01400:Dcx	APN	X	142,714,150 (GRCm39)	missense	possibly damaging	0.96
R1913:Dcx	UTSW	X	142,706,099 (GRCm39)	missense	probably damaging	1.00
R2897:Dcx	UTSW	X	142,706,428 (GRCm39)	splice site	probably benign
R3080:Dcx	UTSW	X	142,706,266 (GRCm39)	missense	probably damaging	1.00
R3689:Dcx	UTSW	X	142,660,240 (GRCm39)	missense	possibly damaging	0.67
R3690:Dcx	UTSW	X	142,660,240 (GRCm39)	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TTCTCCCAAATGAGATAGAGTGTC -3'
(R):5'- GTGCTCAAGCCAGAGAGAAC -3'

Sequencing Primer
(F):5'- GTTCCAGGACAGCCAGAGTTAC -3'
(R):5'- CAAGGACTTTGTGCGCCC -3'

Posted On

2015-02-05