Incidental Mutation 'R3116:Moxd1'
ID264036
Institutional Source Beutler Lab
Gene Symbol Moxd1
Ensembl Gene ENSMUSG00000020000
Gene Namemonooxygenase, DBH-like 1
Synonyms3230402N08Rik
MMRRC Submission 040589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R3116 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24223517-24302790 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 24301531 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 582 (E582*)
Ref Sequence ENSEMBL: ENSMUSP00000093460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095784]
Predicted Effect probably null
Transcript: ENSMUST00000095784
AA Change: E582*
SMART Domains Protein: ENSMUSP00000093460
Gene: ENSMUSG00000020000
AA Change: E582*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DoH 59 148 7.89e-15 SMART
Pfam:Cu2_monooxygen 186 315 2.7e-50 PFAM
Pfam:Cu2_monoox_C 334 491 2.1e-48 PFAM
low complexity region 602 613 N/A INTRINSIC
Meta Mutation Damage Score 0.6392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,896,610 I37F possibly damaging Het
Ccdc146 T C 5: 21,316,955 N357S probably benign Het
Csmd3 A G 15: 47,657,599 F2783S probably damaging Het
Desi2 T A 1: 178,244,442 M104K probably damaging Het
Disp1 C T 1: 183,088,922 V645I probably benign Het
Dock8 A T 19: 25,188,494 H1914L probably benign Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Ffar3 T C 7: 30,855,806 M30V probably benign Het
Grm3 A T 5: 9,570,752 F164Y probably damaging Het
Ints5 T C 19: 8,894,772 S32P possibly damaging Het
Itgam T A 7: 128,116,029 S908R probably damaging Het
Kif20b C T 19: 34,970,080 P1565L probably benign Het
Kntc1 A G 5: 123,802,058 E1610G probably damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
March6 G A 15: 31,486,119 S362F probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Ncor2 A T 5: 125,024,166 L2195Q probably damaging Het
Neil1 A T 9: 57,146,663 D124E probably benign Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nipbl T A 15: 8,343,592 M1057L probably benign Het
Npas3 G A 12: 54,067,725 probably null Het
Oas1h C T 5: 120,861,616 Q55* probably null Het
Olfr39 A T 9: 20,286,227 H176L probably benign Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Olfr701 T A 7: 106,818,364 F94I probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Pum1 T C 4: 130,772,660 V1051A probably damaging Het
Pxdn T C 12: 30,002,307 S828P possibly damaging Het
Rad21 T A 15: 51,965,001 E557V probably null Het
Rtn3 T G 19: 7,431,990 N888H probably damaging Het
Slc12a5 T A 2: 164,996,181 probably null Het
Slc7a11 T A 3: 50,384,139 M274L probably benign Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Tacc2 A G 7: 130,759,249 N825S probably damaging Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tln2 T A 9: 67,355,139 D610V probably benign Het
Tmed11 C T 5: 108,779,839 V110M probably damaging Het
Tmem92 T C 11: 94,782,428 D3G possibly damaging Het
Trp53rkb C T 2: 166,794,089 probably benign Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp804a C A 2: 82,259,417 Q1197K probably damaging Het
Other mutations in Moxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL00227:Moxd1 APN 10 24282593 missense probably damaging 1.00
IGL00331:Moxd1 APN 10 24282555 splice site probably benign
IGL01074:Moxd1 APN 10 24279384 missense probably benign 0.45
IGL01462:Moxd1 APN 10 24244388 critical splice donor site probably null
IGL01777:Moxd1 APN 10 24252596 missense probably benign 0.00
IGL02051:Moxd1 APN 10 24253018 splice site probably null
IGL02272:Moxd1 APN 10 24282700 nonsense probably null
IGL02343:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL02425:Moxd1 APN 10 24279436 missense probably benign 0.01
IGL02448:Moxd1 APN 10 24282719 missense probably damaging 0.99
IGL02452:Moxd1 APN 10 24282752 missense probably damaging 1.00
IGL03301:Moxd1 APN 10 24279484 missense probably damaging 0.99
R0631:Moxd1 UTSW 10 24252954 missense probably damaging 1.00
R1436:Moxd1 UTSW 10 24244358 missense probably damaging 1.00
R1484:Moxd1 UTSW 10 24223860 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1713:Moxd1 UTSW 10 24281496 missense probably damaging 1.00
R1954:Moxd1 UTSW 10 24279883 missense probably benign 0.17
R3115:Moxd1 UTSW 10 24301531 nonsense probably null
R5183:Moxd1 UTSW 10 24279547 critical splice donor site probably null
R5183:Moxd1 UTSW 10 24287136 missense probably damaging 1.00
R5322:Moxd1 UTSW 10 24244253 missense possibly damaging 0.88
R5728:Moxd1 UTSW 10 24223683 missense possibly damaging 0.92
R5824:Moxd1 UTSW 10 24287097 missense probably damaging 1.00
R6158:Moxd1 UTSW 10 24284777 missense probably damaging 1.00
R6322:Moxd1 UTSW 10 24284811 missense probably damaging 1.00
R6662:Moxd1 UTSW 10 24284760 missense probably damaging 1.00
R6827:Moxd1 UTSW 10 24279850 missense probably benign 0.29
R6928:Moxd1 UTSW 10 24300288 missense probably damaging 1.00
R7048:Moxd1 UTSW 10 24281476 missense probably damaging 1.00
X0063:Moxd1 UTSW 10 24252500 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCTGTGGGTCACAATCCC -3'
(R):5'- CAGGCCTCACATAAACATGGTC -3'

Sequencing Primer
(F):5'- CCTGACTATTATAACGAGGAACCTGG -3'
(R):5'- GGTCTTTAACCTGACTTTAAGGGAC -3'
Posted On2015-02-05