Incidental Mutation 'R3083:Olfr1228'
ID264059
Institutional Source Beutler Lab
Gene Symbol Olfr1228
Ensembl Gene ENSMUSG00000099486
Gene Nameolfactory receptor 1228
SynonymsMOR233-1, GA_x6K02T2Q125-50696209-50695274
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3083 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89247964-89254062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89249001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 231 (V231G)
Ref Sequence ENSEMBL: ENSMUSP00000139920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099789] [ENSMUST00000190757] [ENSMUST00000215447] [ENSMUST00000216392]
Predicted Effect probably damaging
Transcript: ENSMUST00000099789
AA Change: V231G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097377
Gene: ENSMUSG00000101480
AA Change: V231G

DomainStartEndE-ValueType
Pfam:7tm_4 41 315 4.2e-48 PFAM
Pfam:7tm_1 51 298 4.1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190757
AA Change: V231G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139920
Gene: ENSMUSG00000099486
AA Change: V231G

DomainStartEndE-ValueType
Pfam:7tm_1 51 298 2.6e-27 PFAM
Pfam:7tm_4 150 292 2.9e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215447
AA Change: V219G

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216392
AA Change: V219G

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Armc2 T C 10: 41,966,730 D359G probably damaging Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Dennd4a A G 9: 64,906,081 N1441D probably benign Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm15446 A G 5: 109,943,292 N470S possibly damaging Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Hist3h2ba A G 11: 58,948,976 K13E probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Lrp1b A T 2: 40,600,324 M275K probably damaging Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Nlrp5 T C 7: 23,430,163 F885S probably benign Het
Olfr102 T C 17: 37,314,195 N63S probably damaging Het
Olfr917 A G 9: 38,665,616 V76A probably damaging Het
Plcl2 T A 17: 50,687,744 N1080K probably benign Het
Rab3gap2 T A 1: 185,204,269 S10T probably benign Het
Rtca G A 3: 116,508,025 probably benign Het
Scn1a A G 2: 66,299,637 F1278S probably damaging Het
Slitrk3 T C 3: 73,048,595 D948G probably benign Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Ssh3 C T 19: 4,262,559 R586H probably benign Het
Tomm40l A T 1: 171,221,211 L78H probably damaging Het
Vmn2r4 A G 3: 64,389,367 S666P probably damaging Het
Other mutations in Olfr1228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr1228 APN 2 89249222 missense probably benign 0.00
IGL02588:Olfr1228 APN 2 89249698 splice site probably benign
R0384:Olfr1228 UTSW 2 89249070 missense possibly damaging 0.82
R0600:Olfr1228 UTSW 2 89249398 nonsense probably null
R0613:Olfr1228 UTSW 2 89249125 missense probably damaging 1.00
R1564:Olfr1228 UTSW 2 89249672 missense probably benign 0.00
R2115:Olfr1228 UTSW 2 89249530 missense probably damaging 1.00
R2313:Olfr1228 UTSW 2 89248941 missense probably damaging 1.00
R3790:Olfr1228 UTSW 2 89248993 missense probably benign 0.02
R3948:Olfr1228 UTSW 2 89248992 missense possibly damaging 0.95
R4373:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4376:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4825:Olfr1228 UTSW 2 89248690 utr 3 prime probably null
R5022:Olfr1228 UTSW 2 89249417 missense probably benign 0.00
R5141:Olfr1228 UTSW 2 89249129 nonsense probably null
R5313:Olfr1228 UTSW 2 89249377 missense probably benign 0.05
R6010:Olfr1228 UTSW 2 89248743 missense probably benign 0.00
R7354:Olfr1228 UTSW 2 89248687 utr 3 prime probably null
R7548:Olfr1228 UTSW 2 89249086 missense not run
Predicted Primers PCR Primer
(F):5'- TTATGATGGTGGCAAATACAAAGGC -3'
(R):5'- ATGACCAGGAGACTCTGTGG -3'

Sequencing Primer
(F):5'- TGGGATCCACATGTGGA -3'
(R):5'- GGACAGGAGGATTCTTACATTCTCTC -3'
Posted On2015-02-05