Incidental Mutation 'R3122:Vmn2r71'
ID264110
Institutional Source Beutler Lab
Gene Symbol Vmn2r71
Ensembl Gene ENSMUSG00000091205
Gene Namevomeronasal 2, receptor 71
SynonymsEG233445
MMRRC Submission 040595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3122 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85574614-85624547 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 85615620 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 53 (Y53*)
Ref Sequence ENSEMBL: ENSMUSP00000132337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172338]
Predicted Effect probably null
Transcript: ENSMUST00000172338
AA Change: Y53*
SMART Domains Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205
AA Change: Y53*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.1e-31 PFAM
Pfam:NCD3G 511 563 8.7e-20 PFAM
Pfam:7tm_3 593 831 2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208545
Meta Mutation Damage Score 0.6388 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,628,232 N8S possibly damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccbe1 A G 18: 66,066,829 M274T probably benign Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc17 G T 4: 116,599,552 probably benign Het
Ccdc85a C A 11: 28,583,499 C15F unknown Het
Cpt1c A G 7: 44,959,921 Y715H probably damaging Het
Dmwd T A 7: 19,080,695 F423L probably damaging Het
Dock3 C G 9: 106,911,343 A1598P probably damaging Het
Ext2 A G 2: 93,813,825 L37P probably damaging Het
Fam120a T C 13: 48,892,086 D758G possibly damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm9776 A T 13: 94,358,686 probably benign Het
Grik1 A T 16: 88,006,473 M277K probably damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Hephl1 A G 9: 15,088,969 F329S possibly damaging Het
Kif13a G A 13: 46,764,596 probably benign Het
Knl1 T A 2: 119,068,944 H375Q probably benign Het
Lox A G 18: 52,525,105 F332S probably damaging Het
Ltf G A 9: 111,022,900 C135Y probably damaging Het
Madd A G 2: 91,176,209 Y347H probably damaging Het
Mboat1 T C 13: 30,238,048 Y387H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 T C 13: 100,408,995 T1342A probably damaging Het
Naip6 T C 13: 100,316,523 D10G probably benign Het
Nudt8 A G 19: 4,002,015 R209G possibly damaging Het
Olfr1082 A T 2: 86,594,610 Y73N possibly damaging Het
Olfr1183 G T 2: 88,461,509 M75I probably damaging Het
Olfr679 T C 7: 105,086,178 V154A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Phactr1 T A 13: 43,059,573 S131T possibly damaging Het
Phactr3 A G 2: 178,331,618 I475V probably damaging Het
Pip T A 6: 41,851,885 N121K probably damaging Het
Pla2g4d T C 2: 120,278,903 R222G probably benign Het
Rbm42 A G 7: 30,649,727 probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Svep1 C T 4: 58,087,845 V1745I possibly damaging Het
Tnfsf15 T A 4: 63,734,285 E96D probably benign Het
Vmn1r217 A G 13: 23,114,079 S218P probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Wrnip1 A G 13: 32,802,761 D175G probably benign Het
Zscan2 G A 7: 80,863,344 A26T probably benign Het
Other mutations in Vmn2r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Vmn2r71 APN 7 85618693 missense probably benign
IGL00960:Vmn2r71 APN 7 85624374 missense probably damaging 1.00
IGL01372:Vmn2r71 APN 7 85620814 splice site probably benign
IGL01690:Vmn2r71 APN 7 85615574 missense probably damaging 1.00
IGL01909:Vmn2r71 APN 7 85620793 missense probably benign 0.00
IGL01950:Vmn2r71 APN 7 85615619 missense probably damaging 0.98
IGL02570:Vmn2r71 APN 7 85615540 missense possibly damaging 0.95
IGL02650:Vmn2r71 APN 7 85624327 missense probably damaging 1.00
IGL02901:Vmn2r71 APN 7 85619262 missense probably benign 0.00
IGL03128:Vmn2r71 APN 7 85619587 missense probably damaging 1.00
IGL03328:Vmn2r71 APN 7 85624291 missense probably damaging 1.00
R0533:Vmn2r71 UTSW 7 85619218 frame shift probably null
R0707:Vmn2r71 UTSW 7 85619432 missense probably benign
R0841:Vmn2r71 UTSW 7 85618541 missense possibly damaging 0.62
R0865:Vmn2r71 UTSW 7 85619308 missense probably benign 0.01
R0883:Vmn2r71 UTSW 7 85623634 missense probably benign 0.19
R0939:Vmn2r71 UTSW 7 85623681 missense possibly damaging 0.70
R1597:Vmn2r71 UTSW 7 85624144 missense possibly damaging 0.46
R1646:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R1719:Vmn2r71 UTSW 7 85621227 missense probably damaging 1.00
R1860:Vmn2r71 UTSW 7 85615574 missense probably damaging 1.00
R2013:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2014:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2015:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2050:Vmn2r71 UTSW 7 85624473 missense probably damaging 1.00
R2084:Vmn2r71 UTSW 7 85618737 missense probably benign 0.03
R2221:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2223:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2245:Vmn2r71 UTSW 7 85624180 missense probably damaging 1.00
R3115:Vmn2r71 UTSW 7 85623658 missense probably damaging 0.97
R3609:Vmn2r71 UTSW 7 85619662 missense probably damaging 1.00
R4093:Vmn2r71 UTSW 7 85621234 missense probably benign 0.00
R4305:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4306:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4334:Vmn2r71 UTSW 7 85619834 missense probably benign 0.01
R4569:Vmn2r71 UTSW 7 85624194 missense possibly damaging 0.66
R4622:Vmn2r71 UTSW 7 85620609 missense probably benign 0.00
R4915:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R4956:Vmn2r71 UTSW 7 85619228 missense probably benign 0.19
R5005:Vmn2r71 UTSW 7 85624144 missense probably damaging 1.00
R5045:Vmn2r71 UTSW 7 85624389 missense probably benign 0.00
R5153:Vmn2r71 UTSW 7 85619222 missense possibly damaging 0.94
R5236:Vmn2r71 UTSW 7 85623669 missense probably damaging 1.00
R5373:Vmn2r71 UTSW 7 85618542 missense possibly damaging 0.79
R5405:Vmn2r71 UTSW 7 85619414 missense probably benign
R5831:Vmn2r71 UTSW 7 85623714 missense probably benign 0.16
R6061:Vmn2r71 UTSW 7 85619274 missense probably benign
R6518:Vmn2r71 UTSW 7 85621228 missense probably damaging 1.00
R6751:Vmn2r71 UTSW 7 85619887 critical splice donor site probably null
R6920:Vmn2r71 UTSW 7 85623900 missense probably damaging 1.00
R7358:Vmn2r71 UTSW 7 85624260 missense possibly damaging 0.81
R7453:Vmn2r71 UTSW 7 85624089 missense probably benign 0.21
R7560:Vmn2r71 UTSW 7 85623907 missense probably benign 0.06
X0025:Vmn2r71 UTSW 7 85618665 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTGCATTTTGCTCTGGC -3'
(R):5'- CCATGGGGTCATTCATTTAGTATCTAC -3'

Sequencing Primer
(F):5'- GCAGTTATTTTGTGGACCAGAAAAAG -3'
(R):5'- ACCTAGAAATTGTGACTCAGAAATG -3'
Posted On2015-02-05