Incidental Mutation 'R3122:Adam18'
ID264112
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Namea disintegrin and metallopeptidase domain 18
SynonymsAdam27, Dtgn3
MMRRC Submission 040595-MU
Accession Numbers

Genbank: NM_010084

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3122 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24602246-24674755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24628232 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 8 (N8S)
Ref Sequence ENSEMBL: ENSMUSP00000148259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000138232] [ENSMUST00000173833]
Predicted Effect probably benign
Transcript: ENSMUST00000033957
AA Change: N556S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: N556S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138232
AA Change: N8S

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000173833
AA Change: N556S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552
AA Change: N556S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 A G 4: 126,417,372 I16T probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccbe1 A G 18: 66,066,829 M274T probably benign Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc17 G T 4: 116,599,552 probably benign Het
Ccdc85a C A 11: 28,583,499 C15F unknown Het
Cpt1c A G 7: 44,959,921 Y715H probably damaging Het
Dmwd T A 7: 19,080,695 F423L probably damaging Het
Dock3 C G 9: 106,911,343 A1598P probably damaging Het
Ext2 A G 2: 93,813,825 L37P probably damaging Het
Fam120a T C 13: 48,892,086 D758G possibly damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm9776 A T 13: 94,358,686 probably benign Het
Grik1 A T 16: 88,006,473 M277K probably damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Hephl1 A G 9: 15,088,969 F329S possibly damaging Het
Kif13a G A 13: 46,764,596 probably benign Het
Knl1 T A 2: 119,068,944 H375Q probably benign Het
Lox A G 18: 52,525,105 F332S probably damaging Het
Ltf G A 9: 111,022,900 C135Y probably damaging Het
Madd A G 2: 91,176,209 Y347H probably damaging Het
Mboat1 T C 13: 30,238,048 Y387H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 T C 13: 100,408,995 T1342A probably damaging Het
Naip6 T C 13: 100,316,523 D10G probably benign Het
Nudt8 A G 19: 4,002,015 R209G possibly damaging Het
Olfr1082 A T 2: 86,594,610 Y73N possibly damaging Het
Olfr1183 G T 2: 88,461,509 M75I probably damaging Het
Olfr679 T C 7: 105,086,178 V154A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Phactr1 T A 13: 43,059,573 S131T possibly damaging Het
Phactr3 A G 2: 178,331,618 I475V probably damaging Het
Pip T A 6: 41,851,885 N121K probably damaging Het
Pla2g4d T C 2: 120,278,903 R222G probably benign Het
Rbm42 A G 7: 30,649,727 probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Svep1 C T 4: 58,087,845 V1745I possibly damaging Het
Tnfsf15 T A 4: 63,734,285 E96D probably benign Het
Vmn1r217 A G 13: 23,114,079 S218P probably damaging Het
Vmn2r71 T G 7: 85,615,620 Y53* probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Wrnip1 A G 13: 32,802,761 D175G probably benign Het
Zscan2 G A 7: 80,863,344 A26T probably benign Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 24628133 missense probably damaging 1.00
IGL01649:Adam18 APN 8 24614896 missense possibly damaging 0.82
IGL02212:Adam18 APN 8 24637179 missense probably benign 0.02
IGL02455:Adam18 APN 8 24651848 missense probably damaging 0.96
IGL02525:Adam18 APN 8 24611044 missense probably benign 0.00
IGL02525:Adam18 APN 8 24641767 splice site probably benign
IGL02966:Adam18 APN 8 24611149 splice site probably benign
IGL03136:Adam18 APN 8 24641836 missense probably damaging 1.00
G5030:Adam18 UTSW 8 24651856 missense probably benign 0.24
R0135:Adam18 UTSW 8 24665542 missense possibly damaging 0.71
R0280:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0389:Adam18 UTSW 8 24629637 splice site probably null
R0390:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0443:Adam18 UTSW 8 24629637 splice site probably null
R0479:Adam18 UTSW 8 24651822 missense probably benign
R0578:Adam18 UTSW 8 24641847 missense possibly damaging 0.82
R0645:Adam18 UTSW 8 24672120 nonsense probably null
R0881:Adam18 UTSW 8 24672143 splice site probably benign
R0885:Adam18 UTSW 8 24651786 missense probably damaging 1.00
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0974:Adam18 UTSW 8 24647853 missense probably benign 0.01
R1005:Adam18 UTSW 8 24665514 missense probably benign 0.05
R1356:Adam18 UTSW 8 24668595 splice site probably benign
R1510:Adam18 UTSW 8 24625831 missense probably benign 0.01
R1552:Adam18 UTSW 8 24646361 missense probably benign
R1568:Adam18 UTSW 8 24647783 splice site probably null
R1639:Adam18 UTSW 8 24652152 missense probably benign 0.00
R1968:Adam18 UTSW 8 24646447 missense probably benign 0.32
R2029:Adam18 UTSW 8 24650877 missense probably damaging 1.00
R2058:Adam18 UTSW 8 24672066 splice site probably benign
R2211:Adam18 UTSW 8 24628155 missense probably damaging 0.96
R2237:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2238:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2239:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2518:Adam18 UTSW 8 24637141 missense probably damaging 1.00
R3426:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3428:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3967:Adam18 UTSW 8 24629710 missense probably benign 0.12
R4833:Adam18 UTSW 8 24674101 missense probably benign 0.01
R4965:Adam18 UTSW 8 24641811 missense probably damaging 1.00
R5249:Adam18 UTSW 8 24625852 missense probably benign 0.00
R5534:Adam18 UTSW 8 24665514 missense probably benign 0.05
R5920:Adam18 UTSW 8 24674075 missense probably damaging 1.00
R6329:Adam18 UTSW 8 24614827 missense probably damaging 1.00
R6450:Adam18 UTSW 8 24629675 missense probably benign 0.05
R6479:Adam18 UTSW 8 24629665 missense probably benign 0.29
R6516:Adam18 UTSW 8 24674687 missense probably damaging 1.00
R6603:Adam18 UTSW 8 24665502 missense possibly damaging 0.63
R7194:Adam18 UTSW 8 24651852 missense possibly damaging 0.67
R7226:Adam18 UTSW 8 24647808 missense probably damaging 1.00
R7266:Adam18 UTSW 8 24667623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGTGGTAGCCATCGTGG -3'
(R):5'- CTGCCACGGTGCTAATTAAC -3'

Sequencing Primer
(F):5'- GCAATTAGCATACATTGACAGAGC -3'
(R):5'- GCCACGGTGCTAATTAACCTATTTG -3'
Posted On2015-02-05