Incidental Mutation 'R0344:Setdb1'
ID26412
Institutional Source Beutler Lab
Gene Symbol Setdb1
Ensembl Gene ENSMUSG00000015697
Gene NameSET domain, bifurcated 1
SynonymsKMT1E, ESET
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95323525-95357202 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 95326131 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171] [ENSMUST00000129267] [ENSMUST00000139866]
Predicted Effect probably benign
Transcript: ENSMUST00000015841
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015858
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107170
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107171
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124638
Predicted Effect probably benign
Transcript: ENSMUST00000129267
SMART Domains Protein: ENSMUSP00000121110
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
transmembrane domain 136 155 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134702
Predicted Effect probably benign
Transcript: ENSMUST00000139866
SMART Domains Protein: ENSMUSP00000120190
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 246 4.28e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154055
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous inactivation of this locus results in peri-implantation lethality. Inner cell mass growth is impaired in null blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Setdb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Setdb1 APN 3 95338577 missense probably damaging 1.00
IGL00915:Setdb1 APN 3 95346788 missense probably damaging 1.00
IGL01339:Setdb1 APN 3 95338580 nonsense probably null
IGL01710:Setdb1 APN 3 95338853 missense probably damaging 1.00
IGL02795:Setdb1 APN 3 95327373 missense probably damaging 1.00
IGL02824:Setdb1 APN 3 95339904 splice site probably benign
IGL02838:Setdb1 APN 3 95337268 splice site probably null
IGL03014:Setdb1 UTSW 3 95341415 missense probably damaging 1.00
R0077:Setdb1 UTSW 3 95341451 missense probably damaging 1.00
R0367:Setdb1 UTSW 3 95349881 splice site probably benign
R0374:Setdb1 UTSW 3 95324853 unclassified probably benign
R0411:Setdb1 UTSW 3 95327686 missense probably damaging 1.00
R0501:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0521:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0616:Setdb1 UTSW 3 95341798 missense probably damaging 1.00
R0828:Setdb1 UTSW 3 95338860 missense probably damaging 1.00
R0990:Setdb1 UTSW 3 95340265 missense probably benign 0.00
R1263:Setdb1 UTSW 3 95327611 missense probably damaging 0.99
R1297:Setdb1 UTSW 3 95349876 splice site probably benign
R1497:Setdb1 UTSW 3 95327467 missense probably benign 0.44
R2885:Setdb1 UTSW 3 95340195 missense probably benign
R2907:Setdb1 UTSW 3 95327201 splice site probably benign
R3236:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3237:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3972:Setdb1 UTSW 3 95341338 missense probably damaging 1.00
R4260:Setdb1 UTSW 3 95327497 missense probably damaging 0.96
R5284:Setdb1 UTSW 3 95327570 missense probably damaging 1.00
R5484:Setdb1 UTSW 3 95337258 missense probably damaging 1.00
R5955:Setdb1 UTSW 3 95338842 missense probably damaging 1.00
R6542:Setdb1 UTSW 3 95340307 missense probably damaging 1.00
R6610:Setdb1 UTSW 3 95328577 missense probably damaging 1.00
R6632:Setdb1 UTSW 3 95324149 missense probably damaging 1.00
R6785:Setdb1 UTSW 3 95326401 missense probably benign 0.09
R7176:Setdb1 UTSW 3 95337147 critical splice donor site probably null
R7250:Setdb1 UTSW 3 95354541 critical splice donor site probably null
R7259:Setdb1 UTSW 3 95339913 missense probably benign 0.08
R7282:Setdb1 UTSW 3 95338674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCACCGTCAGAGCCAGAAGAG -3'
(R):5'- CGAAACAAGATGCCAGTGTAAGTGC -3'

Sequencing Primer
(F):5'- GGTCTGGATGTCATCACTATCAAC -3'
(R):5'- CAGTAGCAACTTGACCCTCTC -3'
Posted On2013-04-16