Incidental Mutation 'R3122:Wapl'
ID264129
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission 040595-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3122 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34729215 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 729 (I729M)
Ref Sequence ENSEMBL: ENSMUSP00000087481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048263
AA Change: I735M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: I735M

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090027
AA Change: I729M

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: I729M

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect unknown
Transcript: ENSMUST00000151285
AA Change: I19M
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408
AA Change: I19M

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169910
AA Change: I735M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: I735M

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172658
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,628,232 N8S possibly damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccbe1 A G 18: 66,066,829 M274T probably benign Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc17 G T 4: 116,599,552 probably benign Het
Ccdc85a C A 11: 28,583,499 C15F unknown Het
Cpt1c A G 7: 44,959,921 Y715H probably damaging Het
Dmwd T A 7: 19,080,695 F423L probably damaging Het
Dock3 C G 9: 106,911,343 A1598P probably damaging Het
Ext2 A G 2: 93,813,825 L37P probably damaging Het
Fam120a T C 13: 48,892,086 D758G possibly damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm9776 A T 13: 94,358,686 probably benign Het
Grik1 A T 16: 88,006,473 M277K probably damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Hephl1 A G 9: 15,088,969 F329S possibly damaging Het
Kif13a G A 13: 46,764,596 probably benign Het
Knl1 T A 2: 119,068,944 H375Q probably benign Het
Lox A G 18: 52,525,105 F332S probably damaging Het
Ltf G A 9: 111,022,900 C135Y probably damaging Het
Madd A G 2: 91,176,209 Y347H probably damaging Het
Mboat1 T C 13: 30,238,048 Y387H probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 T C 13: 100,408,995 T1342A probably damaging Het
Naip6 T C 13: 100,316,523 D10G probably benign Het
Nudt8 A G 19: 4,002,015 R209G possibly damaging Het
Olfr1082 A T 2: 86,594,610 Y73N possibly damaging Het
Olfr1183 G T 2: 88,461,509 M75I probably damaging Het
Olfr679 T C 7: 105,086,178 V154A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Phactr1 T A 13: 43,059,573 S131T possibly damaging Het
Phactr3 A G 2: 178,331,618 I475V probably damaging Het
Pip T A 6: 41,851,885 N121K probably damaging Het
Pla2g4d T C 2: 120,278,903 R222G probably benign Het
Rbm42 A G 7: 30,649,727 probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Svep1 C T 4: 58,087,845 V1745I possibly damaging Het
Tnfsf15 T A 4: 63,734,285 E96D probably benign Het
Vmn1r217 A G 13: 23,114,079 S218P probably damaging Het
Vmn2r71 T G 7: 85,615,620 Y53* probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wrnip1 A G 13: 32,802,761 D175G probably benign Het
Zscan2 G A 7: 80,863,344 A26T probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTTCAAAGAAATGGGTAGCG -3'
(R):5'- TGCTTGTTGTGCACAGTTTCAC -3'

Sequencing Primer
(F):5'- CAAATAGCTATGTTTCCCTAGGC -3'
(R):5'- GCACAGTTTCACAGAGTCTTCGG -3'
Posted On2015-02-05