Incidental Mutation 'R0344:Abca4'
ID26414
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission 038551-MU
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122083964 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 324 (C324Y)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
Predicted Effect probably damaging
Transcript: ENSMUST00000013995
AA Change: C324Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: C324Y

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150738
Meta Mutation Damage Score 0.496 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 intron probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 intron probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAAACGGCCTTCATTCTGTCTGC -3'
(R):5'- TGCCTACAGGACTCAGAGGACTTAC -3'

Sequencing Primer
(F):5'- cccaggttccattcccag -3'
(R):5'- CAGAGGACTTACTTGTTCTTTTGTC -3'
Posted On2013-04-16