Incidental Mutation 'R3123:Tas2r140'
ID264149
Institutional Source Beutler Lab
Gene Symbol Tas2r140
Ensembl Gene ENSMUSG00000071147
Gene Nametaste receptor, type 2, member 140
SynonymsTas2r40, TRB5, T2R40, TRB3, mTRB3, Tas2r13, mt2r64
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location133054817-133055816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133055241 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 185 (I185L)
Ref Sequence ENSEMBL: ENSMUSP00000093040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095391]
Predicted Effect probably benign
Transcript: ENSMUST00000095391
AA Change: I185L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093040
Gene: ENSMUSG00000071147
AA Change: I185L

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 6.7e-86 PFAM
Meta Mutation Damage Score 0.1392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Tas2r140
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0244:Tas2r140 UTSW 6 133055327 missense possibly damaging 0.46
R0666:Tas2r140 UTSW 6 133055442 missense probably benign 0.22
R1174:Tas2r140 UTSW 6 133054871 missense probably benign 0.27
R1237:Tas2r140 UTSW 6 133055208 missense probably benign 0.04
R1553:Tas2r140 UTSW 6 133055508 missense probably damaging 0.99
R2030:Tas2r140 UTSW 6 133055250 missense probably benign 0.23
R3124:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R4233:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4234:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4236:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4525:Tas2r140 UTSW 6 133055244 missense possibly damaging 0.66
R4803:Tas2r140 UTSW 6 133055780 missense possibly damaging 0.77
R4840:Tas2r140 UTSW 6 133055565 missense probably benign 0.01
R5317:Tas2r140 UTSW 6 133055580 missense probably benign 0.06
R5937:Tas2r140 UTSW 6 133055273 missense probably benign 0.01
R6142:Tas2r140 UTSW 6 133055735 missense probably damaging 1.00
R7127:Tas2r140 UTSW 6 133054959 missense possibly damaging 0.62
R7143:Tas2r140 UTSW 6 133055519 missense probably benign 0.00
R7178:Tas2r140 UTSW 6 133055660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATGACAAGTGCCAGAAAG -3'
(R):5'- TGGCTTGCTACATGTCTCAGC -3'

Sequencing Primer
(F):5'- CATGACAAGTGCCAGAAAGAAAATG -3'
(R):5'- GGAGGGTAAAAACTGTGGTTTC -3'
Posted On2015-02-05