Incidental Mutation 'R3123:Pthlh'
ID264150
Institutional Source Beutler Lab
Gene Symbol Pthlh
Ensembl Gene ENSMUSG00000048776
Gene Nameparathyroid hormone-like peptide
Synonymsparathyroid hormone-like hormone, PTH-related peptide, parathyroid hormone-related peptide, parathyroid hormone-related protein, PTH-like, Pthrp
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3123 (G1)
Quality Score154
Status Validated
Chromosome6
Chromosomal Location147252101-147264183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147263291 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 27 (V27E)
Ref Sequence ENSEMBL: ENSMUSP00000145509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052296] [ENSMUST00000204197]
Predicted Effect probably damaging
Transcript: ENSMUST00000052296
AA Change: V27E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051433
Gene: ENSMUSG00000048776
AA Change: V27E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204197
AA Change: V27E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145509
Gene: ENSMUSG00000048776
AA Change: V27E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PTH 35 70 2.26e-18 SMART
low complexity region 115 144 N/A INTRINSIC
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the parathyroid family of hormones that possesses distinct paracrine and intracrine signaling roles such as regulation of circulating calcium, transplacental calcium transport, osteoclast inhibition, renal bicarbonate excretion and regulation of apoptosis. The encoded protein undergoes proteolytic processing to generate multiple active peptides with distinct signaling functions. The homozygous deletion of this gene leads to death shortly after birth with a chondrodystrophic phenotype characterized by premature chondrocyte differentiation and accelerated bone formation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dischondroplasia associated with premature maturation of chondrocytes and die postnatally from asphyxia. Mutants rescued from neonatal lethality lack mammary development and tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Pthlh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Pthlh APN 6 147252575 missense probably benign 0.15
IGL02450:Pthlh APN 6 147257168 missense possibly damaging 0.95
R0847:Pthlh UTSW 6 147263268 critical splice donor site probably null
R2171:Pthlh UTSW 6 147257196 missense probably damaging 1.00
R2174:Pthlh UTSW 6 147257012 missense probably benign 0.00
R3124:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R3125:Pthlh UTSW 6 147263291 missense probably damaging 0.98
R4660:Pthlh UTSW 6 147257298 missense probably damaging 1.00
R5234:Pthlh UTSW 6 147257094 missense probably damaging 1.00
R5244:Pthlh UTSW 6 147257153 missense probably damaging 1.00
R5809:Pthlh UTSW 6 147257247 missense probably damaging 0.99
R6475:Pthlh UTSW 6 147257190 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGATGGCTTTCCTGGGCTC -3'
(R):5'- AGATGCCCTCGACTTTGGAG -3'

Sequencing Primer
(F):5'- ACTGTGTCCAACTCAGGT -3'
(R):5'- TGGCTGTTGGGAAGCCAC -3'
Posted On2015-02-05