Incidental Mutation 'R3123:Macc1'
ID264168
Institutional Source Beutler Lab
Gene Symbol Macc1
Ensembl Gene ENSMUSG00000041886
Gene Namemetastasis associated in colon cancer 1
Synonyms
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location119314270-119469987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119447633 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 712 (F712S)
Ref Sequence ENSEMBL: ENSMUSP00000152677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048880] [ENSMUST00000221866] [ENSMUST00000221917] [ENSMUST00000222058] [ENSMUST00000222784]
Predicted Effect probably damaging
Transcript: ENSMUST00000048880
AA Change: F712S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042955
Gene: ENSMUSG00000041886
AA Change: F712S

DomainStartEndE-ValueType
low complexity region 127 141 N/A INTRINSIC
Pfam:ZU5 213 307 3.5e-10 PFAM
SH3 551 617 3.74e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221866
AA Change: F712S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221917
AA Change: F712S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222058
AA Change: F712S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222784
AA Change: F712S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MACC1 is a key regulator of the hepatocyte growth factor (HGF; MIM 142409)-HGF receptor (HGFR, or MET; MIM 164860) pathway, which is involved in cellular growth, epithelial-mesenchymal transition, angiogenesis, cell motility, invasiveness, and metastasis. Expression of MACC1 in colon cancer (MIM 114500) specimens is an independent prognostic indicator for metastasis formation and metastasis-free survival (Stein et al., 2009 [PubMed 19098908]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Macc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Macc1 APN 12 119447014 missense probably benign 0.16
IGL01515:Macc1 APN 12 119450371 missense probably damaging 1.00
IGL01638:Macc1 APN 12 119446511 missense probably benign 0.00
IGL01653:Macc1 APN 12 119450353 missense probably damaging 1.00
IGL01982:Macc1 APN 12 119445634 missense probably benign 0.12
IGL02177:Macc1 APN 12 119465557 missense probably damaging 1.00
IGL02263:Macc1 APN 12 119446017 missense possibly damaging 0.87
IGL03199:Macc1 APN 12 119446421 missense probably benign 0.24
IGL03246:Macc1 APN 12 119446685 missense probably benign 0.00
IGL03265:Macc1 APN 12 119446976 missense probably benign 0.00
IGL03306:Macc1 APN 12 119446868 missense probably benign 0.00
IGL03307:Macc1 APN 12 119446420 missense probably benign
IGL03386:Macc1 APN 12 119445863 missense probably benign
PIT4366001:Macc1 UTSW 12 119446949 missense probably benign 0.01
PIT4431001:Macc1 UTSW 12 119446511 missense probably benign 0.00
R0033:Macc1 UTSW 12 119446341 missense probably benign 0.03
R0166:Macc1 UTSW 12 119447080 nonsense probably null
R0528:Macc1 UTSW 12 119447045 missense probably benign 0.09
R0688:Macc1 UTSW 12 119447003 missense probably damaging 0.96
R0725:Macc1 UTSW 12 119447516 nonsense probably null
R1356:Macc1 UTSW 12 119446555 missense probably benign 0.00
R1647:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1648:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1938:Macc1 UTSW 12 119445731 missense probably damaging 1.00
R2362:Macc1 UTSW 12 119447658 splice site probably benign
R2406:Macc1 UTSW 12 119465611 missense probably damaging 0.99
R3713:Macc1 UTSW 12 119446841 missense probably benign
R3915:Macc1 UTSW 12 119446816 missense probably benign 0.13
R5256:Macc1 UTSW 12 119446529 missense possibly damaging 0.87
R5329:Macc1 UTSW 12 119446477 missense probably damaging 1.00
R5555:Macc1 UTSW 12 119450375 missense probably benign 0.24
R5992:Macc1 UTSW 12 119447585 missense probably damaging 0.96
R6024:Macc1 UTSW 12 119450425 missense probably benign 0.01
R6064:Macc1 UTSW 12 119445665 missense probably benign 0.14
R6196:Macc1 UTSW 12 119446050 missense probably damaging 1.00
R6697:Macc1 UTSW 12 119447256 missense possibly damaging 0.73
R7046:Macc1 UTSW 12 119447038 missense probably benign 0.02
R7060:Macc1 UTSW 12 119447455 missense probably damaging 1.00
R7094:Macc1 UTSW 12 119450391 nonsense probably null
R7120:Macc1 UTSW 12 119445745 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGCCTTGCCATTTAAAAGTCTGAC -3'
(R):5'- GAATCCAAAGCTATGACCTTGC -3'

Sequencing Primer
(F):5'- GTATTGACCTTGGTGTCAGAAAAAG -3'
(R):5'- TGCACAAAAAGTGGAAAACCTTTTGG -3'
Posted On2015-02-05