Incidental Mutation 'R3123:Olfr131'
ID264176
Institutional Source Beutler Lab
Gene Symbol Olfr131
Ensembl Gene ENSMUSG00000043312
Gene Nameolfactory receptor 131
SynonymsGA_x6K02T2PSCP-2531299-2530355, MOR256-4
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3123 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38081624-38088693 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to A at 38082012 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059560] [ENSMUST00000172933] [ENSMUST00000215940] [ENSMUST00000216523]
Predicted Effect probably null
Transcript: ENSMUST00000059560
SMART Domains Protein: ENSMUSP00000061861
Gene: ENSMUSG00000043312

DomainStartEndE-ValueType
Pfam:7tm_1 43 294 4e-35 PFAM
Pfam:7tm_4 141 287 2.7e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172933
SMART Domains Protein: ENSMUSP00000134532
Gene: ENSMUSG00000043312

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.5e-57 PFAM
Pfam:7tm_1 43 294 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173218
Predicted Effect probably benign
Transcript: ENSMUST00000215940
Predicted Effect probably benign
Transcript: ENSMUST00000216523
Meta Mutation Damage Score 0.6644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Olfr131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr131 APN 17 38082653 missense possibly damaging 0.48
IGL01287:Olfr131 APN 17 38082107 missense probably damaging 1.00
IGL01637:Olfr131 APN 17 38082103 missense possibly damaging 0.90
IGL02833:Olfr131 APN 17 38082352 missense possibly damaging 0.84
IGL02927:Olfr131 APN 17 38082223 missense probably benign 0.00
R0662:Olfr131 UTSW 17 38082933 missense probably benign 0.09
R0755:Olfr131 UTSW 17 38082194 nonsense probably null
R1526:Olfr131 UTSW 17 38082595 missense probably damaging 0.99
R2155:Olfr131 UTSW 17 38082180 missense probably damaging 1.00
R3125:Olfr131 UTSW 17 38082012 utr 3 prime probably null
R4135:Olfr131 UTSW 17 38082357 missense possibly damaging 0.52
R4244:Olfr131 UTSW 17 38082430 missense probably benign 0.12
R5104:Olfr131 UTSW 17 38082283 missense possibly damaging 0.47
R5182:Olfr131 UTSW 17 38082114 missense probably benign 0.03
R5293:Olfr131 UTSW 17 38082240 missense probably damaging 1.00
R5738:Olfr131 UTSW 17 38082456 missense probably damaging 1.00
R5924:Olfr131 UTSW 17 38082363 missense probably benign 0.01
R6218:Olfr131 UTSW 17 38082729 missense probably damaging 0.98
R6362:Olfr131 UTSW 17 38082729 missense probably damaging 0.99
R6961:Olfr131 UTSW 17 38082205 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTTGTTTATGGCTCCAAATGAC -3'
(R):5'- TACATGGCACCGAAGAGCAG -3'

Sequencing Primer
(F):5'- CCCTGTTCTGGGGCATATAAAG -3'
(R):5'- GCACCGAAGAGCAGCTCAG -3'
Posted On2015-02-05