Incidental Mutation 'R0344:Hp1bp3'
ID26419
Institutional Source Beutler Lab
Gene Symbol Hp1bp3
Ensembl Gene ENSMUSG00000028759
Gene Nameheterochromatin protein 1, binding protein 3
SynonymsHp1bp74
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location138216296-138244683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138237209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 348 (S348F)
Ref Sequence ENSEMBL: ENSMUSP00000132614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030541] [ENSMUST00000097836] [ENSMUST00000105825] [ENSMUST00000105826] [ENSMUST00000105827] [ENSMUST00000148681] [ENSMUST00000165861]
Predicted Effect probably damaging
Transcript: ENSMUST00000030541
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030541
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097836
AA Change: S310F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095447
Gene: ENSMUSG00000028759
AA Change: S310F

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 2.82e-18 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105825
AA Change: S310F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101451
Gene: ENSMUSG00000028759
AA Change: S310F

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 1.3e-17 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105826
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101452
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105827
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101453
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148681
AA Change: S184F

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122005
Gene: ENSMUSG00000028759
AA Change: S184F

DomainStartEndE-ValueType
H15 3 60 2.05e-6 SMART
H15 89 156 7.29e-12 SMART
H15 171 239 1.78e-15 SMART
low complexity region 263 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155344
Predicted Effect probably damaging
Transcript: ENSMUST00000165861
AA Change: S348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132614
Gene: ENSMUSG00000028759
AA Change: S348F

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Meta Mutation Damage Score 0.398 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Hp1bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Hp1bp3 APN 4 138240629 missense possibly damaging 0.85
IGL02407:Hp1bp3 APN 4 138240672 missense probably damaging 1.00
IGL03036:Hp1bp3 APN 4 138228732 missense probably damaging 1.00
Supermicro UTSW 4 138225897 missense probably damaging 1.00
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0128:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0130:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0132:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0522:Hp1bp3 UTSW 4 138222161 missense possibly damaging 0.77
R0652:Hp1bp3 UTSW 4 138228769 missense possibly damaging 0.75
R1240:Hp1bp3 UTSW 4 138229698 missense probably damaging 1.00
R1793:Hp1bp3 UTSW 4 138230509 missense probably damaging 1.00
R1871:Hp1bp3 UTSW 4 138222186 missense probably damaging 1.00
R2018:Hp1bp3 UTSW 4 138221632 missense probably damaging 1.00
R2060:Hp1bp3 UTSW 4 138240672 missense probably damaging 1.00
R2255:Hp1bp3 UTSW 4 138225898 missense probably damaging 0.98
R3721:Hp1bp3 UTSW 4 138239608 missense probably damaging 1.00
R3930:Hp1bp3 UTSW 4 138221707 missense probably benign 0.29
R5042:Hp1bp3 UTSW 4 138222108 start codon destroyed probably null 0.99
R5423:Hp1bp3 UTSW 4 138225897 missense probably damaging 1.00
R5583:Hp1bp3 UTSW 4 138222115 missense probably damaging 1.00
R5597:Hp1bp3 UTSW 4 138221628 start codon destroyed possibly damaging 0.91
R6051:Hp1bp3 UTSW 4 138234304 missense possibly damaging 0.93
R6208:Hp1bp3 UTSW 4 138217170 start gained probably benign
R7077:Hp1bp3 UTSW 4 138239618 missense probably damaging 1.00
X0027:Hp1bp3 UTSW 4 138241673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTATCTGTGCTGAGGCAGGAG -3'
(R):5'- ACCTAGCACCTGAAAAGCTGAGGC -3'

Sequencing Primer
(F):5'- CTGAGGCAGGAGCCGAC -3'
(R):5'- ggatcaaactcacaatcatctatcac -3'
Posted On2013-04-16