Incidental Mutation 'R3124:Ctr9'
ID264198
Institutional Source Beutler Lab
Gene Symbol Ctr9
Ensembl Gene ENSMUSG00000005609
Gene NameCTR9 homolog, Paf1/RNA polymerase II complex component
SynonymsTsbp, Tsp, Sh2bp1
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location111028951-111056377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111053446 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 984 (R984C)
Ref Sequence ENSEMBL: ENSMUSP00000005749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005749]
Predicted Effect unknown
Transcript: ENSMUST00000005749
AA Change: R984C
SMART Domains Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: R984C

DomainStartEndE-ValueType
TPR 163 196 2.26e-3 SMART
TPR 198 231 2e-4 SMART
low complexity region 232 241 N/A INTRINSIC
TPR 306 339 4.52e-3 SMART
TPR 341 374 1.39e-3 SMART
TPR 451 484 3.56e-1 SMART
TPR 497 530 7.34e-3 SMART
TPR 531 564 3.24e-4 SMART
Blast:TPR 565 598 2e-14 BLAST
TPR 681 714 9.03e-3 SMART
TPR 717 750 1.6e1 SMART
coiled coil region 828 889 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
low complexity region 923 928 N/A INTRINSIC
low complexity region 932 1002 N/A INTRINSIC
low complexity region 1005 1028 N/A INTRINSIC
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1072 1090 N/A INTRINSIC
low complexity region 1133 1159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209912
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Ctr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ctr9 APN 7 111049331 missense probably damaging 1.00
IGL02379:Ctr9 APN 7 111051519 missense probably damaging 0.99
IGL02451:Ctr9 APN 7 111043424 nonsense probably null
IGL03222:Ctr9 APN 7 111043050 missense probably benign 0.41
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0586:Ctr9 UTSW 7 111049498 splice site probably benign
R0761:Ctr9 UTSW 7 111046272 missense probably damaging 0.97
R0834:Ctr9 UTSW 7 111050952 missense probably benign 0.06
R1593:Ctr9 UTSW 7 111042853 missense possibly damaging 0.82
R1711:Ctr9 UTSW 7 111055663 missense unknown
R1828:Ctr9 UTSW 7 111043958 synonymous probably null
R1838:Ctr9 UTSW 7 111052303 missense possibly damaging 0.93
R2037:Ctr9 UTSW 7 111046807 missense probably benign 0.04
R2171:Ctr9 UTSW 7 111046910 missense possibly damaging 0.69
R2512:Ctr9 UTSW 7 111046871 missense probably damaging 1.00
R2850:Ctr9 UTSW 7 111053446 missense unknown
R2851:Ctr9 UTSW 7 111053446 missense unknown
R4049:Ctr9 UTSW 7 111055543 missense unknown
R4280:Ctr9 UTSW 7 111046723 intron probably benign
R4350:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4352:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4460:Ctr9 UTSW 7 111046894 missense probably benign 0.01
R4740:Ctr9 UTSW 7 111035371 missense probably benign 0.31
R5039:Ctr9 UTSW 7 111042857 missense probably benign 0.28
R5216:Ctr9 UTSW 7 111045458 missense possibly damaging 0.68
R5647:Ctr9 UTSW 7 111055544 missense unknown
R5677:Ctr9 UTSW 7 111044002 missense probably benign 0.45
R6907:Ctr9 UTSW 7 111030242 missense probably damaging 1.00
Z1088:Ctr9 UTSW 7 111030224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCCTTGAGTGCATAG -3'
(R):5'- AGAGTGTACTGTGGCACTCTG -3'

Sequencing Primer
(F):5'- GCCCTTGAGTGCATAGTATAGC -3'
(R):5'- GTACTGTGGCACTCTGTCAGAC -3'
Posted On2015-02-05