Incidental Mutation 'R3124:Cd80'
ID264212
Institutional Source Beutler Lab
Gene Symbol Cd80
Ensembl Gene ENSMUSG00000075122
Gene NameCD80 antigen
SynonymsLy53, B7-1, Ly-53, Cd28l, B7.1
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38455561-38496335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38473893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 46 (V46E)
Ref Sequence ENSEMBL: ENSMUSP00000156252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099816] [ENSMUST00000231716] [ENSMUST00000232409]
Predicted Effect probably damaging
Transcript: ENSMUST00000099816
AA Change: V46E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097404
Gene: ENSMUSG00000075122
AA Change: V46E

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
IG 39 138 5.08e-5 SMART
Pfam:Ig_3 140 223 3.5e-5 PFAM
Pfam:C2-set_2 145 230 1.4e-20 PFAM
transmembrane domain 249 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231716
AA Change: V46E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232409
AA Change: V46E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in a 70% reduction in the mixed lymphocyte response in LPS- and dextran sulfate-stimulated B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Cd80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02524:Cd80 APN 16 38482683 missense probably benign 0.41
FR4304:Cd80 UTSW 16 38486315 small insertion probably benign
FR4340:Cd80 UTSW 16 38486316 small insertion probably benign
FR4548:Cd80 UTSW 16 38486319 small insertion probably benign
R0605:Cd80 UTSW 16 38482694 missense probably benign 0.07
R1213:Cd80 UTSW 16 38473883 missense probably damaging 0.99
R1905:Cd80 UTSW 16 38474177 missense probably damaging 1.00
R5154:Cd80 UTSW 16 38473980 missense probably benign 0.34
R5316:Cd80 UTSW 16 38473877 nonsense probably null
R5730:Cd80 UTSW 16 38482735 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCAAGTTCCAGGACAATCAGAG -3'
(R):5'- ACCAGGCCCAGGATGATAAG -3'

Sequencing Primer
(F):5'- GTTCCAGGACAATCAGAGCTACATAG -3'
(R):5'- ATGATAAGAGAGTAGGTAGTGTTGTC -3'
Posted On2015-02-05