Incidental Mutation 'R0344:Agap3'
ID26424
Institutional Source Beutler Lab
Gene Symbol Agap3
Ensembl Gene ENSMUSG00000023353
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 3
SynonymsCrag, Centg3, MRIP-1
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24452177-24502047 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 24451202 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024123] [ENSMUST00000030799] [ENSMUST00000115033] [ENSMUST00000115036] [ENSMUST00000123167] [ENSMUST00000127194] [ENSMUST00000212381]
Predicted Effect probably benign
Transcript: ENSMUST00000024123
SMART Domains Protein: ENSMUSP00000024123
Gene: ENSMUSG00000023353

DomainStartEndE-ValueType
low complexity region 4 59 N/A INTRINSIC
Pfam:Ras 128 286 1.2e-18 PFAM
low complexity region 328 345 N/A INTRINSIC
PH 403 642 2.76e-16 SMART
ArfGap 661 781 9.17e-51 SMART
ANK 820 849 2.43e1 SMART
ANK 853 885 9.17e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030799
SMART Domains Protein: ENSMUSP00000030799
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000101490
AA Change: N169S
SMART Domains Protein: ENSMUSP00000099029
Gene: ENSMUSG00000073129
AA Change: N169S

DomainStartEndE-ValueType
low complexity region 65 77 N/A INTRINSIC
low complexity region 96 106 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115033
SMART Domains Protein: ENSMUSP00000110685
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115036
SMART Domains Protein: ENSMUSP00000110688
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
UBQ 117 186 4.58e-4 SMART
low complexity region 190 206 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123167
SMART Domains Protein: ENSMUSP00000122487
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
Blast:UBQ 102 122 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127194
SMART Domains Protein: ENSMUSP00000123173
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
low complexity region 175 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199647
Predicted Effect probably benign
Transcript: ENSMUST00000212381
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Agap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Agap3 APN 5 24498109 missense probably damaging 0.99
IGL00900:Agap3 APN 5 24476368 splice site probably benign
IGL00966:Agap3 APN 5 24501002 splice site probably benign
IGL02207:Agap3 APN 5 24499936 missense probably benign
IGL02431:Agap3 APN 5 24501012 missense probably damaging 1.00
IGL02601:Agap3 APN 5 24483371 missense possibly damaging 0.67
IGL03090:Agap3 APN 5 24501206 missense possibly damaging 0.91
IGL03131:Agap3 APN 5 24477132 missense probably benign 0.16
IGL03247:Agap3 APN 5 24487822 missense probably damaging 1.00
R0165:Agap3 UTSW 5 24479745 missense probably damaging 0.98
R0496:Agap3 UTSW 5 24501243 missense probably damaging 1.00
R0542:Agap3 UTSW 5 24500186 missense possibly damaging 0.95
R1427:Agap3 UTSW 5 24476693 missense probably benign 0.03
R1840:Agap3 UTSW 5 24500231 missense probably damaging 1.00
R1903:Agap3 UTSW 5 24493013 missense probably damaging 1.00
R2101:Agap3 UTSW 5 24487799 missense probably damaging 1.00
R4601:Agap3 UTSW 5 24476408 missense probably damaging 1.00
R4745:Agap3 UTSW 5 24451125 unclassified probably null
R4807:Agap3 UTSW 5 24477116 missense probably damaging 1.00
R4808:Agap3 UTSW 5 24501245 missense probably benign
R4916:Agap3 UTSW 5 24478013 missense probably damaging 0.98
R5056:Agap3 UTSW 5 24477862 missense probably damaging 1.00
R5094:Agap3 UTSW 5 24451321 unclassified probably benign
R5646:Agap3 UTSW 5 24483397 missense probably benign 0.01
R5937:Agap3 UTSW 5 24477817 missense probably damaging 0.99
R6365:Agap3 UTSW 5 24474985 missense probably benign 0.43
R6798:Agap3 UTSW 5 24498282 intron probably null
R6802:Agap3 UTSW 5 24487793 missense possibly damaging 0.87
R6863:Agap3 UTSW 5 24452463 missense possibly damaging 0.63
R6863:Agap3 UTSW 5 24452464 nonsense probably null
R7039:Agap3 UTSW 5 24483401 missense probably benign 0.01
R7111:Agap3 UTSW 5 24501398 missense probably damaging 1.00
R7313:Agap3 UTSW 5 24452384 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGGGTCATTCCCTTGCACATGC -3'
(R):5'- GTGGAATCCTTGGGCTACTCAGAAC -3'

Sequencing Primer
(F):5'- ATGCCACCTCCAGGTTTGAG -3'
(R):5'- GGGCTACTCAGAACTGTTCTC -3'
Posted On2013-04-16