Incidental Mutation 'R3125:Kif15'
ID264247
Institutional Source Beutler Lab
Gene Symbol Kif15
Ensembl Gene ENSMUSG00000036768
Gene Namekinesin family member 15
SynonymsHKLP2, Knsl7, N-10 kinesin
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122951046-123018733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122987961 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 542 (Q542P)
Ref Sequence ENSEMBL: ENSMUSP00000035490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000213745] [ENSMUST00000214652]
Predicted Effect probably damaging
Transcript: ENSMUST00000040717
AA Change: Q542P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: Q542P

DomainStartEndE-ValueType
KISc 24 371 2.86e-179 SMART
Pfam:Kinesin-relat_1 463 551 6.6e-26 PFAM
coiled coil region 579 643 N/A INTRINSIC
coiled coil region 706 1037 N/A INTRINSIC
coiled coil region 1065 1133 N/A INTRINSIC
Pfam:HMMR_C 1265 1387 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214183
Predicted Effect probably damaging
Transcript: ENSMUST00000214652
AA Change: Q314P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217415
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Serpina12 G A 12: 104,037,983 T130I probably benign Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Kif15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Kif15 APN 9 122975755 missense probably damaging 1.00
IGL01577:Kif15 APN 9 122996334 missense probably benign 0.06
IGL01647:Kif15 APN 9 122963471 intron probably benign
IGL01921:Kif15 APN 9 122979504 missense probably damaging 1.00
IGL02040:Kif15 APN 9 123017385 missense probably damaging 0.99
IGL02191:Kif15 APN 9 122975679 missense probably damaging 1.00
IGL02218:Kif15 APN 9 122995827 splice site probably benign
IGL02537:Kif15 APN 9 122993849 missense probably benign 0.08
IGL02814:Kif15 APN 9 123003640 missense possibly damaging 0.83
PIT4480001:Kif15 UTSW 9 123011543 missense probably benign
R0034:Kif15 UTSW 9 122999285 missense possibly damaging 0.47
R0458:Kif15 UTSW 9 123009359 missense probably benign
R0526:Kif15 UTSW 9 122997797 missense probably damaging 0.96
R0533:Kif15 UTSW 9 123009433 unclassified probably benign
R0726:Kif15 UTSW 9 122959928 missense probably benign 0.21
R1580:Kif15 UTSW 9 122959956 missense probably benign 0.22
R1597:Kif15 UTSW 9 122994009 missense probably benign 0.22
R2096:Kif15 UTSW 9 122986187 missense probably damaging 1.00
R3176:Kif15 UTSW 9 122987840 splice site probably benign
R4088:Kif15 UTSW 9 122986189 missense probably benign 0.29
R4308:Kif15 UTSW 9 123013982 missense probably benign 0.00
R4597:Kif15 UTSW 9 122993849 missense probably benign 0.08
R4705:Kif15 UTSW 9 122959993 splice site probably null
R4832:Kif15 UTSW 9 123002126 splice site probably null
R5100:Kif15 UTSW 9 122991994 missense probably damaging 0.98
R5126:Kif15 UTSW 9 122975758 missense probably damaging 1.00
R5180:Kif15 UTSW 9 122999210 missense probably damaging 0.99
R5247:Kif15 UTSW 9 122986442 missense possibly damaging 0.65
R5376:Kif15 UTSW 9 122993971 missense probably benign 0.04
R5392:Kif15 UTSW 9 122996295 missense probably damaging 0.99
R5422:Kif15 UTSW 9 122984889 synonymous probably null
R5562:Kif15 UTSW 9 122978016 missense probably damaging 1.00
R5663:Kif15 UTSW 9 122991851 splice site probably null
R5767:Kif15 UTSW 9 123013974 missense possibly damaging 0.78
R5927:Kif15 UTSW 9 123017261 missense probably benign 0.00
R6049:Kif15 UTSW 9 123011622 missense probably damaging 0.98
R6435:Kif15 UTSW 9 122986491 missense probably damaging 1.00
R7040:Kif15 UTSW 9 123011614 missense possibly damaging 0.67
R7158:Kif15 UTSW 9 122999314 missense probably benign
R7163:Kif15 UTSW 9 123017657 missense probably damaging 1.00
R7197:Kif15 UTSW 9 123009926 critical splice donor site probably null
R7318:Kif15 UTSW 9 122987949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCAGAGAGACCAATTCAC -3'
(R):5'- TCGAAGGCCAGAAACTAGCC -3'

Sequencing Primer
(F):5'- TCAGAGAGACCAATTCACTTAGG -3'
(R):5'- GTTCTAGAAACTCAGGGCCTCATG -3'
Posted On2015-02-05