Incidental Mutation 'R0344:Ablim2'
ID26425
Institutional Source Beutler Lab
Gene Symbol Ablim2
Ensembl Gene ENSMUSG00000029095
Gene Nameactin-binding LIM protein 2
Synonyms
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location35757880-35884973 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 35836933 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000054598] [ENSMUST00000101280] [ENSMUST00000114203] [ENSMUST00000114204] [ENSMUST00000114205] [ENSMUST00000114206] [ENSMUST00000114210] [ENSMUST00000129347] [ENSMUST00000130233] [ENSMUST00000150146]
Predicted Effect probably benign
Transcript: ENSMUST00000054598
SMART Domains Protein: ENSMUSP00000050571
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 577 612 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101280
SMART Domains Protein: ENSMUSP00000098838
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 297 315 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
VHP 572 607 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114203
SMART Domains Protein: ENSMUSP00000109841
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
PDB:1WIG|A 1 28 5e-13 PDB
low complexity region 35 53 N/A INTRINSIC
low complexity region 132 141 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
VHP 311 346 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114204
SMART Domains Protein: ENSMUSP00000109842
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
VHP 571 606 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114205
SMART Domains Protein: ENSMUSP00000109843
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 538 573 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114206
SMART Domains Protein: ENSMUSP00000109844
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 375 384 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
VHP 582 617 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114210
SMART Domains Protein: ENSMUSP00000109848
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125378
SMART Domains Protein: ENSMUSP00000115931
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 1 115 6.3e-29 PFAM
low complexity region 136 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129347
SMART Domains Protein: ENSMUSP00000123525
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
Pfam:AbLIM_anchor 295 513 2.1e-78 PFAM
Pfam:AbLIM_anchor 497 628 2.6e-37 PFAM
VHP 629 664 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130233
SMART Domains Protein: ENSMUSP00000118159
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-6 BLAST
PDB:1WIG|A 1 28 7e-13 PDB
low complexity region 54 72 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135885
Predicted Effect probably benign
Transcript: ENSMUST00000150146
Predicted Effect probably benign
Transcript: ENSMUST00000151322
SMART Domains Protein: ENSMUSP00000114616
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 12 164 4.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151636
SMART Domains Protein: ENSMUSP00000123616
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 22 148 5.6e-54 PFAM
low complexity region 171 183 N/A INTRINSIC
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Ablim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ablim2 APN 5 35824015 unclassified probably benign
IGL00945:Ablim2 APN 5 35837020 missense probably damaging 1.00
IGL02439:Ablim2 APN 5 35857862 missense possibly damaging 0.89
IGL02664:Ablim2 APN 5 35849516 missense probably damaging 1.00
IGL02897:Ablim2 APN 5 35833126 missense probably damaging 1.00
IGL03034:Ablim2 APN 5 35828165 missense probably benign 0.00
IGL03096:Ablim2 APN 5 35883399 nonsense probably null
IGL03384:Ablim2 APN 5 35874872 missense probably damaging 1.00
R0128:Ablim2 UTSW 5 35809176 splice site probably benign
R0130:Ablim2 UTSW 5 35809176 splice site probably benign
R0212:Ablim2 UTSW 5 35848910 splice site probably null
R0675:Ablim2 UTSW 5 35866780 splice site probably benign
R0788:Ablim2 UTSW 5 35857901 missense probably benign 0.01
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1493:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1809:Ablim2 UTSW 5 35843270 intron probably benign
R2070:Ablim2 UTSW 5 35798513 missense probably damaging 1.00
R2163:Ablim2 UTSW 5 35802353 splice site probably benign
R3962:Ablim2 UTSW 5 35812175 missense probably damaging 1.00
R4852:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4853:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4854:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4855:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4866:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4867:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4906:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4908:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4909:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4927:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R5210:Ablim2 UTSW 5 35837072 missense probably benign 0.44
R5225:Ablim2 UTSW 5 35866771 splice site probably null
R5439:Ablim2 UTSW 5 35857826 missense probably damaging 0.98
R5528:Ablim2 UTSW 5 35856166 nonsense probably null
R5629:Ablim2 UTSW 5 35857163 missense probably benign 0.01
R5653:Ablim2 UTSW 5 35883412 missense probably damaging 1.00
R5921:Ablim2 UTSW 5 35812211 missense probably damaging 1.00
R6059:Ablim2 UTSW 5 35857164 missense probably benign 0.37
R6241:Ablim2 UTSW 5 35874897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCACTGTCGTGCCCTGAATC -3'
(R):5'- TGAAGAGCCATACCTCGCCATAGC -3'

Sequencing Primer
(F):5'- AACGGCTTCAGTGTCTGAC -3'
(R):5'- CGCCATAGCTCTGCCTG -3'
Posted On2013-04-16