Incidental Mutation 'R3147:Il6ra'
ID 264273
Institutional Source Beutler Lab
Gene Symbol Il6ra
Ensembl Gene ENSMUSG00000027947
Gene Name interleukin 6 receptor, alpha
Synonyms CD126, IL-6 receptor alpha chain, IL-6R, Il6r
MMRRC Submission 040599-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3147 (G1)
Quality Score 193
Status Not validated
Chromosome 3
Chromosomal Location 89776631-89820503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 89793235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 305 (P305Q)
Ref Sequence ENSEMBL: ENSMUSP00000143541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029559] [ENSMUST00000197679]
AlphaFold P22272
Predicted Effect probably benign
Transcript: ENSMUST00000029559
AA Change: P305Q

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029559
Gene: ENSMUSG00000027947
AA Change: P305Q

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
IGc2 38 99 1.35e-9 SMART
Pfam:IL6Ra-bind 109 210 2.9e-21 PFAM
FN3 213 298 2.18e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197679
AA Change: P305Q

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143541
Gene: ENSMUSG00000027947
AA Change: P305Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 38 99 5.7e-12 SMART
Pfam:IL6Ra-bind 109 210 6.8e-19 PFAM
FN3 213 298 1.1e-4 SMART
transmembrane domain 362 384 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit defective T helper 17 cells development. Mice homozygous for a different knock-out allele exhibit abnormaly inflammatory response and abnormal wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 66,964,984 (GRCm39) D12G probably benign Het
Alg2 A T 4: 47,472,259 (GRCm39) V183D probably damaging Het
Amy1 T C 3: 113,363,697 (GRCm39) probably benign Het
Asb15 G T 6: 24,566,258 (GRCm39) A404S probably damaging Het
Atf2 T C 2: 73,681,283 (GRCm39) probably null Het
Atosa A G 9: 74,916,120 (GRCm39) I240V probably benign Het
Baalc A T 15: 38,812,568 (GRCm39) E106V possibly damaging Het
Catsperd G T 17: 56,971,039 (GRCm39) C701F possibly damaging Het
Cc2d2a T A 5: 43,866,497 (GRCm39) I769N probably damaging Het
Ccdc158 T C 5: 92,805,822 (GRCm39) N311S probably damaging Het
Dbx1 C A 7: 49,286,297 (GRCm39) R56L probably damaging Het
Eif4enif1 T A 11: 3,194,003 (GRCm39) probably null Het
Elmod3 T G 6: 72,563,485 (GRCm39) T48P probably benign Het
Erbb2 T C 11: 98,324,865 (GRCm39) S820P probably damaging Het
Gimap8 T C 6: 48,627,440 (GRCm39) V138A probably damaging Het
H1f5 T C 13: 21,964,285 (GRCm39) probably benign Het
Kcng3 A G 17: 83,895,749 (GRCm39) V239A possibly damaging Het
Kcnrg T C 14: 61,845,140 (GRCm39) F60S probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lama1 A G 17: 68,044,653 (GRCm39) D184G probably damaging Het
Lhcgr A T 17: 89,065,771 (GRCm39) L206Q probably damaging Het
Lhx3 T C 2: 26,091,277 (GRCm39) D344G probably benign Het
Marf1 A G 16: 13,943,843 (GRCm39) V1380A possibly damaging Het
Mtcl2 T G 2: 156,862,284 (GRCm39) K1548N possibly damaging Het
Mtfr1 T C 3: 19,271,374 (GRCm39) V182A probably benign Het
Or14a259 A G 7: 86,013,092 (GRCm39) L151S probably benign Het
Or5p64 C T 7: 107,854,883 (GRCm39) G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,229,115 (GRCm39) probably benign Het
Snx4 A C 16: 33,108,094 (GRCm39) D296A probably benign Het
Sox7 A T 14: 64,186,083 (GRCm39) Y373F probably damaging Het
Tuba1b T C 15: 98,830,386 (GRCm39) T145A probably benign Het
Usp32 T A 11: 84,919,913 (GRCm39) N718I probably damaging Het
Wapl G A 14: 34,447,106 (GRCm39) V648M probably damaging Het
Zfp85 C T 13: 67,900,612 (GRCm39) V10M probably damaging Het
Zgrf1 A G 3: 127,377,797 (GRCm39) N1014S possibly damaging Het
Other mutations in Il6ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Il6ra APN 3 89,793,350 (GRCm39) missense probably damaging 0.97
IGL02198:Il6ra APN 3 89,797,655 (GRCm39) missense probably benign 0.07
IGL02363:Il6ra APN 3 89,778,560 (GRCm39) missense probably benign 0.00
IGL03109:Il6ra APN 3 89,784,165 (GRCm39) nonsense probably null
R0105:Il6ra UTSW 3 89,784,125 (GRCm39) missense probably damaging 1.00
R0569:Il6ra UTSW 3 89,785,149 (GRCm39) critical splice donor site probably null
R0926:Il6ra UTSW 3 89,794,376 (GRCm39) missense probably damaging 0.99
R1837:Il6ra UTSW 3 89,797,579 (GRCm39) missense probably benign 0.00
R1838:Il6ra UTSW 3 89,797,579 (GRCm39) missense probably benign 0.00
R4478:Il6ra UTSW 3 89,797,597 (GRCm39) missense probably damaging 1.00
R5470:Il6ra UTSW 3 89,793,302 (GRCm39) missense probably benign 0.05
R5572:Il6ra UTSW 3 89,778,589 (GRCm39) missense probably damaging 1.00
R6169:Il6ra UTSW 3 89,778,598 (GRCm39) missense probably benign 0.15
R6300:Il6ra UTSW 3 89,794,436 (GRCm39) missense probably damaging 0.97
R6543:Il6ra UTSW 3 89,784,170 (GRCm39) missense probably damaging 1.00
R7129:Il6ra UTSW 3 89,778,554 (GRCm39) missense probably damaging 0.99
R8023:Il6ra UTSW 3 89,820,260 (GRCm39) critical splice donor site probably null
R8682:Il6ra UTSW 3 89,793,976 (GRCm39) missense possibly damaging 0.88
R8997:Il6ra UTSW 3 89,794,418 (GRCm39) missense probably damaging 1.00
R9697:Il6ra UTSW 3 89,785,219 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAACACATGGGCAGCCAG -3'
(R):5'- CTGTAGCATTGCCTCACAGAG -3'

Sequencing Primer
(F):5'- CCAGAAGTTCAAGGTCATGTTGAC -3'
(R):5'- GAGGCCACTGAGACTCACCATG -3'
Posted On 2015-02-05