Incidental Mutation 'R0344:Taf6'
ID26429
Institutional Source Beutler Lab
Gene Symbol Taf6
Ensembl Gene ENSMUSG00000036980
Gene NameTATA-box binding protein associated factor 6
SynonymsTaf2e, p80, 80kDa
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138178617-138187451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 138181147 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 377 (I377L)
Ref Sequence ENSEMBL: ENSMUSP00000106562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019662] [ENSMUST00000048698] [ENSMUST00000110936] [ENSMUST00000110937] [ENSMUST00000123415] [ENSMUST00000139276] [ENSMUST00000143241] [ENSMUST00000153117]
Predicted Effect probably benign
Transcript: ENSMUST00000019662
SMART Domains Protein: ENSMUSP00000019662
Gene: ENSMUSG00000019518

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 142 2e-49 SMART
Pfam:Adap_comp_sub 173 449 2.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048698
AA Change: I377L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048016
Gene: ENSMUSG00000036980
AA Change: I377L

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1e-35 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110936
AA Change: I377L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106561
Gene: ENSMUSG00000036980
AA Change: I377L

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:TAF6_C 308 397 1.1e-33 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110937
AA Change: I377L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106562
Gene: ENSMUSG00000036980
AA Change: I377L

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1.9e-36 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 549 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123415
SMART Domains Protein: ENSMUSP00000122534
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134100
Predicted Effect probably benign
Transcript: ENSMUST00000139276
SMART Domains Protein: ENSMUSP00000116512
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
Pfam:TAF 11 55 2.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142687
Predicted Effect probably benign
Transcript: ENSMUST00000143241
SMART Domains Protein: ENSMUSP00000123770
Gene: ENSMUSG00000019518

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 86 2e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153117
SMART Domains Protein: ENSMUSP00000138335
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200483
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds weakly to TBP but strongly to TAF1, the largest subunit of TFIID. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Taf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Taf6 APN 5 138180907 missense probably damaging 1.00
IGL02445:Taf6 APN 5 138184494 utr 5 prime probably benign
IGL02734:Taf6 APN 5 138183856 missense possibly damaging 0.82
IGL02861:Taf6 APN 5 138183885 missense probably damaging 1.00
IGL02983:Taf6 APN 5 138178880 missense probably benign
PIT4515001:Taf6 UTSW 5 138182242 missense probably benign 0.32
R0189:Taf6 UTSW 5 138182713 missense probably benign 0.00
R0567:Taf6 UTSW 5 138183726 splice site probably null
R1082:Taf6 UTSW 5 138182687 missense possibly damaging 0.92
R2375:Taf6 UTSW 5 138182201 nonsense probably null
R4466:Taf6 UTSW 5 138181201 splice site probably benign
R4845:Taf6 UTSW 5 138182647 missense possibly damaging 0.83
R4959:Taf6 UTSW 5 138183203 nonsense probably null
R4973:Taf6 UTSW 5 138183203 nonsense probably null
R5059:Taf6 UTSW 5 138179447 missense probably benign 0.15
R5232:Taf6 UTSW 5 138179952 missense possibly damaging 0.80
R7211:Taf6 UTSW 5 138178826 missense possibly damaging 0.53
X0019:Taf6 UTSW 5 138182200 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACGGTCGATGTTGCTCAGCAC -3'
(R):5'- AGTATACCATGTACTCCAGGCAGGC -3'

Sequencing Primer
(F):5'- TTGCTCAGCACAGGCCC -3'
(R):5'- TGTGCCAGGTTAGCCTTTCT -3'
Posted On2013-04-16