Incidental Mutation 'R0344:Ankrd26'
ID26431
Institutional Source Beutler Lab
Gene Symbol Ankrd26
Ensembl Gene ENSMUSG00000007827
Gene Nameankyrin repeat domain 26
Synonyms5730521P14Rik
MMRRC Submission 038551-MU
Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118501308-118562226 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 118507637 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112830]
Predicted Effect probably null
Transcript: ENSMUST00000112830
SMART Domains Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827

DomainStartEndE-ValueType
ANK 80 109 1.5e-7 SMART
ANK 113 142 3.5e-4 SMART
ANK 146 175 1.9e-6 SMART
ANK 179 208 2.2e-4 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Blast:BRLZ 692 754 4e-10 BLAST
Pfam:CCDC144C 886 1190 2e-142 PFAM
low complexity region 1298 1315 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
coiled coil region 1407 1444 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
Pfam:DUF3496 1495 1602 1.3e-47 PFAM
Meta Mutation Damage Score 0.464 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Ankrd26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ankrd26 APN 6 118559358 nonsense probably null
IGL01286:Ankrd26 APN 6 118559107 missense probably damaging 1.00
IGL01574:Ankrd26 APN 6 118539698 missense probably damaging 1.00
IGL01727:Ankrd26 APN 6 118511636 missense probably damaging 1.00
IGL01954:Ankrd26 APN 6 118559005 missense possibly damaging 0.62
IGL02200:Ankrd26 APN 6 118559341 missense probably damaging 1.00
IGL02708:Ankrd26 APN 6 118518418 splice site probably benign
IGL02973:Ankrd26 APN 6 118523550 missense probably damaging 0.98
IGL03233:Ankrd26 APN 6 118535146 splice site probably null
ANU74:Ankrd26 UTSW 6 118552775 missense probably benign 0.02
N/A:Ankrd26 UTSW 6 118529574 missense probably benign 0.04
R0078:Ankrd26 UTSW 6 118535069 splice site probably benign
R0083:Ankrd26 UTSW 6 118523254 missense probably benign 0.36
R0165:Ankrd26 UTSW 6 118540484 missense probably benign 0.01
R0828:Ankrd26 UTSW 6 118533473 splice site probably benign
R1532:Ankrd26 UTSW 6 118522958 missense probably damaging 1.00
R1809:Ankrd26 UTSW 6 118525922 splice site probably benign
R1875:Ankrd26 UTSW 6 118540449 critical splice donor site probably null
R1940:Ankrd26 UTSW 6 118511693 missense probably damaging 1.00
R2164:Ankrd26 UTSW 6 118525791 missense probably damaging 1.00
R2202:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2204:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2205:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R3107:Ankrd26 UTSW 6 118556243 missense probably benign 0.01
R3419:Ankrd26 UTSW 6 118535107 missense probably damaging 1.00
R3552:Ankrd26 UTSW 6 118507776 missense probably damaging 1.00
R3899:Ankrd26 UTSW 6 118549428 missense probably benign 0.30
R4157:Ankrd26 UTSW 6 118507821 missense probably damaging 1.00
R4194:Ankrd26 UTSW 6 118523678 missense probably benign 0.21
R4230:Ankrd26 UTSW 6 118559388 splice site probably null
R4651:Ankrd26 UTSW 6 118515826 missense probably benign 0.03
R4701:Ankrd26 UTSW 6 118506485 missense possibly damaging 0.65
R4747:Ankrd26 UTSW 6 118527757 missense probably benign 0.01
R4752:Ankrd26 UTSW 6 118540465 missense probably null 1.00
R4834:Ankrd26 UTSW 6 118523718 missense probably benign 0.08
R4835:Ankrd26 UTSW 6 118548850 nonsense probably null
R4849:Ankrd26 UTSW 6 118532296 missense probably benign 0.00
R5149:Ankrd26 UTSW 6 118558996 missense probably benign 0.05
R5389:Ankrd26 UTSW 6 118508575 missense possibly damaging 0.82
R5473:Ankrd26 UTSW 6 118515836 missense probably benign 0.04
R5518:Ankrd26 UTSW 6 118548908 missense probably benign 0.00
R5525:Ankrd26 UTSW 6 118527731 missense probably benign 0.00
R5608:Ankrd26 UTSW 6 118511622 missense probably damaging 1.00
R5639:Ankrd26 UTSW 6 118539724 missense possibly damaging 0.72
R5704:Ankrd26 UTSW 6 118523882 missense probably damaging 0.96
R5927:Ankrd26 UTSW 6 118507636 critical splice donor site probably null
R5943:Ankrd26 UTSW 6 118505746 missense probably damaging 1.00
R5976:Ankrd26 UTSW 6 118517894 critical splice donor site probably null
R6181:Ankrd26 UTSW 6 118548877 missense probably benign 0.15
R6478:Ankrd26 UTSW 6 118511638 missense probably benign 0.28
R6667:Ankrd26 UTSW 6 118507788 missense probably benign 0.02
R6865:Ankrd26 UTSW 6 118523481 missense possibly damaging 0.90
R7224:Ankrd26 UTSW 6 118539727 missense probably benign 0.07
R7287:Ankrd26 UTSW 6 118549637 critical splice donor site probably null
R7301:Ankrd26 UTSW 6 118511663 missense possibly damaging 0.62
X0028:Ankrd26 UTSW 6 118507761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGACATGTAAGCATTCGCTCCC -3'
(R):5'- AACGCTTCGGTTAGAAGTCAGATGG -3'

Sequencing Primer
(F):5'- TTCCcaaaacaaaacaaaacaaaac -3'
(R):5'- GCCCAGGAAGACTTCGATAA -3'
Posted On2013-04-16