Incidental Mutation 'R3148:Kcnj11'
ID 264324
Institutional Source Beutler Lab
Gene Symbol Kcnj11
Ensembl Gene ENSMUSG00000096146
Gene Name potassium inwardly rectifying channel, subfamily J, member 11
Synonyms Kir6.2
MMRRC Submission 040600-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3148 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 45746545-45750215 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45748544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 260 (V260I)
Ref Sequence ENSEMBL: ENSMUSP00000147439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180081] [ENSMUST00000209291] [ENSMUST00000209881] [ENSMUST00000211674]
AlphaFold Q61743
Predicted Effect probably benign
Transcript: ENSMUST00000180081
AA Change: V173I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136002
Gene: ENSMUSG00000096146
AA Change: V173I

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:IRK 36 360 4.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209863
Predicted Effect probably benign
Transcript: ENSMUST00000209881
Predicted Effect probably benign
Transcript: ENSMUST00000211674
AA Change: V260I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired insulin secretion, mild glucose intolerance, reduced glucagon secretion in response to hypoglycemia, hypoxia-induced seizure susceptibility, and stress-induced arrhythmia and sudden death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 66,964,984 (GRCm39) D12G probably benign Het
Adamts18 C A 8: 114,465,490 (GRCm39) V701L probably damaging Het
Alg2 A T 4: 47,472,259 (GRCm39) V183D probably damaging Het
Ank2 T C 3: 126,726,724 (GRCm39) I857V probably benign Het
Asb15 G T 6: 24,566,258 (GRCm39) A404S probably damaging Het
Baalc A T 15: 38,812,568 (GRCm39) E106V possibly damaging Het
Catsperd G T 17: 56,971,039 (GRCm39) C701F possibly damaging Het
Cc2d2a T A 5: 43,866,497 (GRCm39) I769N probably damaging Het
Cntnap4 A G 8: 113,484,071 (GRCm39) T375A probably damaging Het
Col7a1 A G 9: 108,790,473 (GRCm39) T974A unknown Het
Ehbp1 T C 11: 22,050,465 (GRCm39) Y502C probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Marf1 A G 16: 13,943,843 (GRCm39) V1380A possibly damaging Het
Or4k36 T C 2: 111,146,633 (GRCm39) F270L possibly damaging Het
Otog T C 7: 45,939,593 (GRCm39) L2124P probably damaging Het
Pam T A 1: 97,823,403 (GRCm39) N256I possibly damaging Het
Pcbp1 C T 6: 86,502,471 (GRCm39) E143K probably damaging Het
Pramel21 A T 4: 143,344,047 (GRCm39) D449V probably benign Het
Prrx1 T C 1: 163,085,417 (GRCm39) D171G probably benign Het
Rasal2 A T 1: 157,071,334 (GRCm39) probably benign Het
Serpinb5 T A 1: 106,809,555 (GRCm39) H320Q probably damaging Het
Snx4 A C 16: 33,108,094 (GRCm39) D296A probably benign Het
Sorcs2 T C 5: 36,193,132 (GRCm39) Q778R probably benign Het
Spata16 T C 3: 26,932,861 (GRCm39) probably null Het
Tcerg1l G T 7: 137,861,596 (GRCm39) Q378K probably benign Het
Trpm1 T C 7: 63,884,760 (GRCm39) Y814H probably benign Het
Other mutations in Kcnj11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Kcnj11 APN 7 45,748,193 (GRCm39) missense probably benign 0.02
IGL01767:Kcnj11 APN 7 45,748,489 (GRCm39) missense probably benign 0.05
IGL01950:Kcnj11 APN 7 45,748,573 (GRCm39) missense probably damaging 1.00
IGL02388:Kcnj11 APN 7 45,749,213 (GRCm39) missense probably benign 0.22
R0019:Kcnj11 UTSW 7 45,748,363 (GRCm39) missense probably benign 0.34
R0710:Kcnj11 UTSW 7 45,748,549 (GRCm39) missense probably benign 0.00
R1216:Kcnj11 UTSW 7 45,749,285 (GRCm39) missense probably benign 0.00
R1819:Kcnj11 UTSW 7 45,748,580 (GRCm39) missense probably benign
R2155:Kcnj11 UTSW 7 45,748,781 (GRCm39) missense probably damaging 1.00
R3498:Kcnj11 UTSW 7 45,749,026 (GRCm39) missense probably damaging 1.00
R4128:Kcnj11 UTSW 7 45,749,143 (GRCm39) missense probably damaging 1.00
R4766:Kcnj11 UTSW 7 45,749,240 (GRCm39) missense probably benign
R4926:Kcnj11 UTSW 7 45,748,544 (GRCm39) missense probably benign 0.00
R5680:Kcnj11 UTSW 7 45,748,232 (GRCm39) missense probably benign
R5708:Kcnj11 UTSW 7 45,749,242 (GRCm39) missense probably benign 0.00
R7487:Kcnj11 UTSW 7 45,748,265 (GRCm39) missense probably benign 0.01
R7788:Kcnj11 UTSW 7 45,749,179 (GRCm39) missense probably damaging 1.00
R7816:Kcnj11 UTSW 7 45,749,281 (GRCm39) missense probably damaging 1.00
R9189:Kcnj11 UTSW 7 45,748,176 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAGTCCACAGAATAGCGGCC -3'
(R):5'- AAGCATGCTGTGATCACCC -3'

Sequencing Primer
(F):5'- ACAGAATAGCGGCCGTCCTC -3'
(R):5'- TGATCACCCTGCGCCATG -3'
Posted On 2015-02-05