Mutagenetix > Incidental Mutation

Incidental Mutation 'R3148:Adamts18'

264329

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 18

Synonyms

E130314N14Rik

MMRRC Submission

040600-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R3148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114423758-114575370 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 114465490 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 701 (V701L)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

AlphaFold

Q4VC17

Predicted Effect

probably damaging
Transcript: ENSMUST00000093113
AA Change: V701L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: V701L

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213076

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	C	X: 66,964,984 (GRCm39)	D12G	probably benign	Het
Alg2	A	T	4: 47,472,259 (GRCm39)	V183D	probably damaging	Het
Ank2	T	C	3: 126,726,724 (GRCm39)	I857V	probably benign	Het
Asb15	G	T	6: 24,566,258 (GRCm39)	A404S	probably damaging	Het
Baalc	A	T	15: 38,812,568 (GRCm39)	E106V	possibly damaging	Het
Catsperd	G	T	17: 56,971,039 (GRCm39)	C701F	possibly damaging	Het
Cc2d2a	T	A	5: 43,866,497 (GRCm39)	I769N	probably damaging	Het
Cntnap4	A	G	8: 113,484,071 (GRCm39)	T375A	probably damaging	Het
Col7a1	A	G	9: 108,790,473 (GRCm39)	T974A	unknown	Het
Ehbp1	T	C	11: 22,050,465 (GRCm39)	Y502C	probably damaging	Het
Kcnj11	C	T	7: 45,748,544 (GRCm39)	V260I	probably benign	Het
Klk14	G	A	7: 43,341,501 (GRCm39)	C51Y	probably damaging	Het
Marf1	A	G	16: 13,943,843 (GRCm39)	V1380A	possibly damaging	Het
Or4k36	T	C	2: 111,146,633 (GRCm39)	F270L	possibly damaging	Het
Otog	T	C	7: 45,939,593 (GRCm39)	L2124P	probably damaging	Het
Pam	T	A	1: 97,823,403 (GRCm39)	N256I	possibly damaging	Het
Pcbp1	C	T	6: 86,502,471 (GRCm39)	E143K	probably damaging	Het
Pramel21	A	T	4: 143,344,047 (GRCm39)	D449V	probably benign	Het
Prrx1	T	C	1: 163,085,417 (GRCm39)	D171G	probably benign	Het
Rasal2	A	T	1: 157,071,334 (GRCm39)		probably benign	Het
Serpinb5	T	A	1: 106,809,555 (GRCm39)	H320Q	probably damaging	Het
Snx4	A	C	16: 33,108,094 (GRCm39)	D296A	probably benign	Het
Sorcs2	T	C	5: 36,193,132 (GRCm39)	Q778R	probably benign	Het
Spata16	T	C	3: 26,932,861 (GRCm39)		probably null	Het
Tcerg1l	G	T	7: 137,861,596 (GRCm39)	Q378K	probably benign	Het
Trpm1	T	C	7: 63,884,760 (GRCm39)	Y814H	probably benign	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	114,501,575 (GRCm39)	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	114,490,931 (GRCm39)	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	114,571,741 (GRCm39)	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	114,469,728 (GRCm39)	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	114,439,826 (GRCm39)	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	114,425,704 (GRCm39)	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	114,440,976 (GRCm39)	splice site	probably benign
IGL03188:Adamts18	APN	8	114,425,656 (GRCm39)	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	114,490,929 (GRCm39)	nonsense	probably null
G1patch:Adamts18	UTSW	8	114,469,833 (GRCm39)	missense	probably damaging	1.00
R0119:Adamts18	UTSW	8	114,501,585 (GRCm39)	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	114,469,749 (GRCm39)	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	114,440,990 (GRCm39)	nonsense	probably null
R0480:Adamts18	UTSW	8	114,465,450 (GRCm39)	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	114,465,401 (GRCm39)	splice site	probably null
R0924:Adamts18	UTSW	8	114,432,028 (GRCm39)	splice site	probably null
R0930:Adamts18	UTSW	8	114,432,028 (GRCm39)	splice site	probably null
R1333:Adamts18	UTSW	8	114,431,805 (GRCm39)	splice site	probably benign
R1441:Adamts18	UTSW	8	114,481,194 (GRCm39)	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	114,501,965 (GRCm39)	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	114,571,635 (GRCm39)	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	114,431,893 (GRCm39)	missense	probably benign	0.36
R3963:Adamts18	UTSW	8	114,504,443 (GRCm39)	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	114,464,212 (GRCm39)	nonsense	probably null
R4486:Adamts18	UTSW	8	114,439,825 (GRCm39)	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	114,464,245 (GRCm39)	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4626:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4627:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4628:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4629:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4710:Adamts18	UTSW	8	114,433,558 (GRCm39)	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	114,463,357 (GRCm39)	nonsense	probably null
R4973:Adamts18	UTSW	8	114,463,357 (GRCm39)	nonsense	probably null
R4976:Adamts18	UTSW	8	114,425,642 (GRCm39)	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	114,425,642 (GRCm39)	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	114,501,902 (GRCm39)	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	114,425,606 (GRCm39)	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	114,501,992 (GRCm39)	nonsense	probably null
R5868:Adamts18	UTSW	8	114,504,380 (GRCm39)	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	114,499,709 (GRCm39)	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	114,436,251 (GRCm39)	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	114,504,380 (GRCm39)	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	114,433,606 (GRCm39)	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	114,501,911 (GRCm39)	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	114,469,833 (GRCm39)	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	114,501,922 (GRCm39)	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	114,501,896 (GRCm39)	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	114,436,277 (GRCm39)	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	114,504,362 (GRCm39)	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	114,439,855 (GRCm39)	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	114,463,566 (GRCm39)	splice site	probably null
R7860:Adamts18	UTSW	8	114,501,908 (GRCm39)	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	114,493,760 (GRCm39)	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	114,481,227 (GRCm39)	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	114,493,795 (GRCm39)	missense	probably damaging	1.00
R8759:Adamts18	UTSW	8	114,433,624 (GRCm39)	missense	probably damaging	1.00
R8934:Adamts18	UTSW	8	114,463,510 (GRCm39)	missense	possibly damaging	0.90
R9405:Adamts18	UTSW	8	114,430,030 (GRCm39)	missense	probably damaging	1.00
R9422:Adamts18	UTSW	8	114,501,910 (GRCm39)	missense	probably damaging	1.00
R9450:Adamts18	UTSW	8	114,490,942 (GRCm39)	missense	probably benign	0.10
R9475:Adamts18	UTSW	8	114,504,570 (GRCm39)	missense	possibly damaging	0.93
Z1088:Adamts18	UTSW	8	114,502,072 (GRCm39)	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	114,469,800 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TGGATGCCTGACCCATCTTC -3'
(R):5'- GCACATCCACGGACATTCTTAC -3'

Sequencing Primer
(F):5'- ATCTTCCCTATGTGCATTGTAGG -3'
(R):5'- ATAGAATGCGATCTGCTTTGCTCAC -3'

Posted On

2015-02-05