Incidental Mutation 'R0344:Sbk3'
ID26433
Institutional Source Beutler Lab
Gene Symbol Sbk3
Ensembl Gene ENSMUSG00000085272
Gene NameSH3 domain binding kinase family, member 3
SynonymsLOC381835, Gm1078
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4965260-4971168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4967405 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 322 (T322S)
Ref Sequence ENSEMBL: ENSMUSP00000122507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032598] [ENSMUST00000133272] [ENSMUST00000144863] [ENSMUST00000182214] [ENSMUST00000183170] [ENSMUST00000208109]
Predicted Effect probably benign
Transcript: ENSMUST00000032598
SMART Domains Protein: ENSMUSP00000032598
Gene: ENSMUSG00000030433

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 2.8e-21 PFAM
Pfam:Pkinase 62 329 1.5e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133272
AA Change: T341S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120654
Gene: ENSMUSG00000085272
AA Change: T341S

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 43 268 1.8e-17 PFAM
Pfam:Pkinase 43 304 1.7e-30 PFAM
Pfam:Kinase-like 130 262 1.6e-8 PFAM
low complexity region 309 321 N/A INTRINSIC
low complexity region 328 347 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144863
AA Change: T322S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122507
Gene: ENSMUSG00000085272
AA Change: T322S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 248 3.1e-17 PFAM
Pfam:Pkinase 24 284 5.6e-32 PFAM
Pfam:Kinase-like 111 237 2.5e-7 PFAM
low complexity region 290 302 N/A INTRINSIC
low complexity region 309 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182214
SMART Domains Protein: ENSMUSP00000138504
Gene: ENSMUSG00000030433

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 3.7e-21 PFAM
Pfam:Pkinase 62 329 6.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182837
Predicted Effect probably benign
Transcript: ENSMUST00000183170
SMART Domains Protein: ENSMUSP00000138187
Gene: ENSMUSG00000030433

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 211 1.9e-18 PFAM
Pfam:Pkinase 62 212 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Catsperg1 A T 7: 29,195,540 V544E probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Sbk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0002:Sbk3 UTSW 7 4970631 missense probably damaging 1.00
R1396:Sbk3 UTSW 7 4967453 missense possibly damaging 0.86
R2115:Sbk3 UTSW 7 4967416 missense possibly damaging 0.86
R4073:Sbk3 UTSW 7 4970502 missense probably damaging 1.00
R4298:Sbk3 UTSW 7 4969980 missense probably benign 0.05
R5347:Sbk3 UTSW 7 4967423 missense probably benign 0.18
R5819:Sbk3 UTSW 7 4969997 missense probably benign 0.38
R6535:Sbk3 UTSW 7 4969841 missense possibly damaging 0.78
R6957:Sbk3 UTSW 7 4967523 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACATCCACATCCAGTGTGTTCC -3'
(R):5'- TTTGACTCGACCTGAAGGCAGC -3'

Sequencing Primer
(F):5'- TCCCCCTTCTCCCAGAACAG -3'
(R):5'- CTGGTTGGATGACCACTAAGC -3'
Posted On2013-04-16