Incidental Mutation 'R3149:Ggta1'
ID264341
Institutional Source Beutler Lab
Gene Symbol Ggta1
Ensembl Gene ENSMUSG00000035778
Gene Nameglycoprotein galactosyltransferase alpha 1, 3
SynonymsGgta, glycoprotein alpha galactosyl transferase 1, GALT, Gal, Ggta-1, alpha3GalT, alpha Gal
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35400179-35463231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35402623 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 224 (I224N)
Ref Sequence ENSEMBL: ENSMUSP00000132408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044255] [ENSMUST00000079424] [ENSMUST00000102794] [ENSMUST00000113001] [ENSMUST00000113002] [ENSMUST00000164889]
Predicted Effect probably damaging
Transcript: ENSMUST00000044255
AA Change: I236N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049408
Gene: ENSMUSG00000035778
AA Change: I236N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 81 404 1.2e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079424
AA Change: I202N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078393
Gene: ENSMUSG00000035778
AA Change: I202N

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 370 5.5e-177 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102794
AA Change: I236N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099858
Gene: ENSMUSG00000035778
AA Change: I236N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 74 404 4.3e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113001
AA Change: I214N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108625
Gene: ENSMUSG00000035778
AA Change: I214N

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 45 382 3.6e-177 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113002
AA Change: I224N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108626
Gene: ENSMUSG00000035778
AA Change: I224N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164889
AA Change: I224N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132408
Gene: ENSMUSG00000035778
AA Change: I224N

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the galactosyltransferase family of intracellular, membrane-bound enzymes that are involved in the biosynthesis of glycoproteins and glycolipids. The encoded protein catalyzes the transfer of galactose from UDP-galactose to N-acetyllactosamine in an alpha(1,3) linkage to form galactose alpha(1,3)-galactose. Mice lacking the encoded protein develop cortical cataracts. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display defects in humoral immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Ggta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ggta1 APN 2 35402450 nonsense probably null
IGL01903:Ggta1 APN 2 35402557 missense possibly damaging 0.74
IGL02796:Ggta1 APN 2 35413317 splice site probably benign
IGL02799:Ggta1 UTSW 2 35422199 missense probably damaging 0.98
R0383:Ggta1 UTSW 2 35402404 missense probably damaging 1.00
R1430:Ggta1 UTSW 2 35408017 missense possibly damaging 0.81
R1667:Ggta1 UTSW 2 35414283 missense possibly damaging 0.83
R1672:Ggta1 UTSW 2 35402133 nonsense probably null
R2246:Ggta1 UTSW 2 35402109 makesense probably null
R3683:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3684:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3685:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R4812:Ggta1 UTSW 2 35402723 missense probably benign 0.01
R4856:Ggta1 UTSW 2 35402791 missense possibly damaging 0.59
R5079:Ggta1 UTSW 2 35422237 missense possibly damaging 0.94
R5756:Ggta1 UTSW 2 35402383 missense probably damaging 1.00
R6279:Ggta1 UTSW 2 35407994 missense probably damaging 1.00
R6651:Ggta1 UTSW 2 35402294 missense probably benign 0.00
R6967:Ggta1 UTSW 2 35402722 missense possibly damaging 0.91
R7152:Ggta1 UTSW 2 35402699 missense probably benign 0.00
R7529:Ggta1 UTSW 2 35414244 missense probably damaging 1.00
R7534:Ggta1 UTSW 2 35402428 missense probably damaging 1.00
R7557:Ggta1 UTSW 2 35402536 missense probably damaging 0.98
X0010:Ggta1 UTSW 2 35402719 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCATAGGTGAACTTCTCGGG -3'
(R):5'- GGTGGTTCAATGTAGCCCTC -3'

Sequencing Primer
(F):5'- AACTTCTCGGGACTGGCCTTG -3'
(R):5'- AATGTAGCCCTCTCTATTTCAGG -3'
Posted On2015-02-05