Incidental Mutation 'R0344:Catsperg1'
ID26435
Institutional Source Beutler Lab
Gene Symbol Catsperg1
Ensembl Gene ENSMUSG00000049676
Gene Namecation channel sperm associated auxiliary subunit gamma 1
SynonymsA230107C01Rik, Catsperg
MMRRC Submission 038551-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0344 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29181321-29214035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29195540 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 544 (V544E)
Ref Sequence ENSEMBL: ENSMUSP00000129837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047846] [ENSMUST00000069861] [ENSMUST00000163782] [ENSMUST00000164653] [ENSMUST00000169143]
Predicted Effect probably benign
Transcript: ENSMUST00000047846
SMART Domains Protein: ENSMUSP00000045233
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 920 N/A PFAM
transmembrane domain 1012 1034 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069861
SMART Domains Protein: ENSMUSP00000067388
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 57 7.9e-14 PFAM
Pfam:CATSPERG 73 205 7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163614
Predicted Effect probably benign
Transcript: ENSMUST00000163782
SMART Domains Protein: ENSMUSP00000127409
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 93 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164653
SMART Domains Protein: ENSMUSP00000131827
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 111 1.4e-44 PFAM
Pfam:CATSPERG 108 334 8.5e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166654
Predicted Effect probably damaging
Transcript: ENSMUST00000169143
AA Change: V544E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129837
Gene: ENSMUSG00000049676
AA Change: V544E

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1111 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172226
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.3%
  • 20x: 93.6%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553J12Rik T A 16: 88,820,301 C29* probably null Het
Abca4 G A 3: 122,083,964 C324Y probably damaging Het
Ablim2 T G 5: 35,836,933 probably benign Het
Abr A T 11: 76,479,044 V115E probably damaging Het
Adgrl2 C T 3: 148,865,595 probably null Het
Aff3 A T 1: 38,203,932 S936T probably benign Het
Agap3 T C 5: 24,451,202 probably benign Het
Ahrr T A 13: 74,214,586 S393C probably damaging Het
Amfr T C 8: 93,987,370 probably null Het
Ankrd26 C A 6: 118,507,637 probably null Het
Asxl3 G A 18: 22,517,611 V886I probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
Atp5s T C 12: 69,740,889 probably benign Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C3ar1 T C 6: 122,850,772 D162G probably benign Het
Camkk2 C T 5: 122,763,877 C123Y probably benign Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cdc27 G A 11: 104,526,991 probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gdap2 G A 3: 100,178,256 G165S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Gns A G 10: 121,383,423 K352E probably benign Het
Gtf2ird2 C T 5: 134,191,249 T22M probably damaging Het
Herc3 A G 6: 58,868,628 probably benign Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Inpp1 A T 1: 52,799,354 F45L probably damaging Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itgae A G 11: 73,118,147 K485E probably benign Het
Jak2 G A 19: 29,283,629 V342I probably damaging Het
Kptn C A 7: 16,125,741 Q297K probably damaging Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nup133 A G 8: 123,917,446 V727A possibly damaging Het
Oas2 T G 5: 120,743,087 E313A probably damaging Het
Olfr1031 T A 2: 85,992,382 C188* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Olfr691 C A 7: 105,337,607 M36I probably benign Het
Olfr961 G A 9: 39,647,350 C208Y probably damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Phldb1 C A 9: 44,701,667 V919L probably benign Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Plekhg3 G T 12: 76,566,266 E449* probably null Het
Pstpip1 T C 9: 56,126,645 V301A probably benign Het
Ptdss1 G A 13: 66,933,572 R22H probably damaging Het
Ptprq A G 10: 107,705,582 V361A probably benign Het
Ralgapa2 A T 2: 146,346,794 V1309E possibly damaging Het
Rere T C 4: 150,610,981 probably benign Het
Sbk3 T A 7: 4,967,405 T322S possibly damaging Het
Scn9a T A 2: 66,505,010 I1203L probably damaging Het
Setdb1 A T 3: 95,326,131 probably benign Het
Sik3 C A 9: 46,208,811 Q683K probably damaging Het
Slc24a5 A G 2: 125,085,701 I307V probably benign Het
Smg6 A G 11: 74,929,821 D306G probably damaging Het
Snx13 G A 12: 35,086,900 W120* probably null Het
Snx5 A G 2: 144,257,208 probably benign Het
Srsf5 T C 12: 80,947,524 S76P probably benign Het
Stard6 A G 18: 70,496,115 D31G probably damaging Het
Taf3 A G 2: 9,951,898 M333T probably benign Het
Taf6 T G 5: 138,181,147 I377L probably benign Het
Taf8 G T 17: 47,493,580 N252K probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Tmem246 T C 4: 49,586,566 T201A probably benign Het
Tmtc4 C T 14: 122,978,160 V25M probably damaging Het
Topbp1 T A 9: 103,328,687 D841E probably damaging Het
Topbp1 T A 9: 103,308,733 probably benign Het
Ttn A T 2: 76,712,489 D33384E probably damaging Het
Unc13c T C 9: 73,930,785 E928G probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r63 A G 7: 42,903,618 I738T probably damaging Het
Vmn2r87 C T 10: 130,479,937 E87K probably damaging Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Other mutations in Catsperg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Catsperg1 APN 7 29198146 missense probably damaging 1.00
IGL01693:Catsperg1 APN 7 29185098 unclassified probably benign
IGL01935:Catsperg1 APN 7 29195871 unclassified probably null
IGL02484:Catsperg1 APN 7 29210920 start gained probably benign
IGL02584:Catsperg1 APN 7 29184721 missense probably damaging 1.00
IGL02880:Catsperg1 APN 7 29195485 missense possibly damaging 0.75
IGL03268:Catsperg1 APN 7 29200243 missense probably damaging 1.00
IGL03285:Catsperg1 APN 7 29198172 missense possibly damaging 0.89
solid UTSW 7 29190298 nonsense probably null
K7894:Catsperg1 UTSW 7 29197154 intron probably benign
R0180:Catsperg1 UTSW 7 29190431 splice site probably null
R0523:Catsperg1 UTSW 7 29185190 unclassified probably benign
R0561:Catsperg1 UTSW 7 29182312 missense probably damaging 1.00
R0610:Catsperg1 UTSW 7 29190619 missense probably damaging 1.00
R0762:Catsperg1 UTSW 7 29189952 missense probably benign 0.03
R1074:Catsperg1 UTSW 7 29206849 missense probably damaging 1.00
R1201:Catsperg1 UTSW 7 29191670 missense possibly damaging 0.77
R1346:Catsperg1 UTSW 7 29182334 splice site probably null
R1387:Catsperg1 UTSW 7 29206864 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1486:Catsperg1 UTSW 7 29185495 missense probably damaging 1.00
R1883:Catsperg1 UTSW 7 29182236 critical splice donor site probably null
R1932:Catsperg1 UTSW 7 29198143 missense probably damaging 1.00
R1942:Catsperg1 UTSW 7 29206807 missense possibly damaging 0.89
R2127:Catsperg1 UTSW 7 29185040 missense probably damaging 1.00
R2205:Catsperg1 UTSW 7 29185246 nonsense probably null
R4214:Catsperg1 UTSW 7 29195932 missense possibly damaging 0.80
R4678:Catsperg1 UTSW 7 29190296 missense probably benign 0.13
R5008:Catsperg1 UTSW 7 29195434 nonsense probably null
R5217:Catsperg1 UTSW 7 29190298 nonsense probably null
R5268:Catsperg1 UTSW 7 29195247 missense probably benign 0.41
R5372:Catsperg1 UTSW 7 29210712 missense probably benign 0.08
R5393:Catsperg1 UTSW 7 29185499 missense probably damaging 1.00
R5406:Catsperg1 UTSW 7 29185523 missense probably damaging 1.00
R5557:Catsperg1 UTSW 7 29195871 missense possibly damaging 0.89
R5921:Catsperg1 UTSW 7 29190523 missense possibly damaging 0.78
R5928:Catsperg1 UTSW 7 29206615 missense probably damaging 0.99
R5960:Catsperg1 UTSW 7 29184783 unclassified probably benign
R6053:Catsperg1 UTSW 7 29210814 nonsense probably null
R6144:Catsperg1 UTSW 7 29210695 missense probably damaging 0.99
R6215:Catsperg1 UTSW 7 29200239 missense probably damaging 1.00
R6334:Catsperg1 UTSW 7 29206357 missense probably benign 0.01
R6446:Catsperg1 UTSW 7 29206567 missense probably benign 0.00
R6854:Catsperg1 UTSW 7 29181702 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGTGGAAACCTTGTAGCTCCCAAC -3'
(R):5'- AACACCAGATGTGCCCATGCTC -3'

Sequencing Primer
(F):5'- GTAGCTCCCAACCTGCTC -3'
(R):5'- AAGAGGTGAGATACCCTGTCTTTC -3'
Posted On2013-04-16