Incidental Mutation 'R3149:Mettl25'
ID264360
Institutional Source Beutler Lab
Gene Symbol Mettl25
Ensembl Gene ENSMUSG00000036009
Gene Namemethyltransferase like 25
SynonymsBC067068
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location105763189-105841380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105826353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 252 (D252G)
Ref Sequence ENSEMBL: ENSMUSP00000038665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046638] [ENSMUST00000176040] [ENSMUST00000176924]
Predicted Effect probably benign
Transcript: ENSMUST00000046638
AA Change: D252G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000038665
Gene: ENSMUSG00000036009
AA Change: D252G

DomainStartEndE-ValueType
Pfam:Methyltransf_32 149 413 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176040
Predicted Effect probably benign
Transcript: ENSMUST00000176924
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Mettl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mettl25 APN 10 105826434 missense probably benign
IGL00698:Mettl25 APN 10 105793340 missense probably null 0.31
IGL00766:Mettl25 APN 10 105779582 splice site probably benign
IGL01360:Mettl25 APN 10 105823197 missense probably damaging 1.00
IGL01954:Mettl25 APN 10 105823207 missense probably damaging 1.00
IGL02088:Mettl25 APN 10 105823250 missense probably damaging 1.00
IGL02623:Mettl25 APN 10 105826324 missense probably damaging 0.96
IGL03245:Mettl25 APN 10 105826497 missense possibly damaging 0.86
IGL03134:Mettl25 UTSW 10 105826027 nonsense probably null
R0238:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R0238:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R0239:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R0239:Mettl25 UTSW 10 105826525 missense probably damaging 1.00
R1297:Mettl25 UTSW 10 105823265 missense probably benign 0.11
R1482:Mettl25 UTSW 10 105826590 missense possibly damaging 0.61
R1526:Mettl25 UTSW 10 105832983 missense possibly damaging 0.56
R1542:Mettl25 UTSW 10 105826120 missense probably benign 0.04
R1589:Mettl25 UTSW 10 105779632 missense probably damaging 1.00
R1901:Mettl25 UTSW 10 105826087 missense probably damaging 0.96
R1902:Mettl25 UTSW 10 105826087 missense probably damaging 0.96
R2016:Mettl25 UTSW 10 105797306 missense probably benign 0.00
R2355:Mettl25 UTSW 10 105763455 missense probably benign 0.00
R2920:Mettl25 UTSW 10 105765177 intron probably null
R4547:Mettl25 UTSW 10 105826017 missense probably damaging 1.00
R4646:Mettl25 UTSW 10 105826555 missense probably damaging 1.00
R4652:Mettl25 UTSW 10 105779648 nonsense probably null
R5020:Mettl25 UTSW 10 105826207 missense possibly damaging 0.87
R5435:Mettl25 UTSW 10 105779586 critical splice donor site probably null
R6947:Mettl25 UTSW 10 105826192 missense probably benign 0.00
R7075:Mettl25 UTSW 10 105829924 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CTGCACCTGTGATGAAGTAGG -3'
(R):5'- TTTGAACGTTTATGGCATCGATTCC -3'

Sequencing Primer
(F):5'- TAGGTTCGATGGCATCAACAG -3'
(R):5'- GTTTATGGCATCGATTCCTCAAACAC -3'
Posted On2015-02-05