Incidental Mutation 'R3149:1700061G19Rik'
List |< first << previous [record 85 of 32981] next >> last >|
ID264373
Institutional Source Beutler Lab
Gene Symbol 1700061G19Rik
Ensembl Gene ENSMUSG00000024209
Gene NameRIKEN cDNA 1700061G19 gene
Synonyms
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56875477-56888904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56876348 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 30 (A30T)
Ref Sequence ENSEMBL: ENSMUSP00000025048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025048] [ENSMUST00000043062]
Predicted Effect probably benign
Transcript: ENSMUST00000025048
AA Change: A30T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025048
Gene: ENSMUSG00000024209
AA Change: A30T

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:AMP-binding 80 554 6.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043062
SMART Domains Protein: ENSMUSP00000042352
Gene: ENSMUSG00000024207

DomainStartEndE-ValueType
Pfam:AMP-binding 53 519 7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125425
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in 1700061G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:1700061G19Rik APN 17 56882203 nonsense probably null
IGL01833:1700061G19Rik APN 17 56881062 missense probably benign 0.02
IGL02420:1700061G19Rik APN 17 56880494 missense probably damaging 1.00
IGL02969:1700061G19Rik APN 17 56883751 missense probably damaging 1.00
IGL03054:1700061G19Rik UTSW 17 56886528 missense possibly damaging 0.67
R0197:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R0257:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0279:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0280:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0281:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0282:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0329:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0330:1700061G19Rik UTSW 17 56883631 missense probably benign 0.02
R0349:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0518:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0519:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0521:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0604:1700061G19Rik UTSW 17 56885169 nonsense probably null
R0883:1700061G19Rik UTSW 17 56883835 missense probably benign 0.01
R1561:1700061G19Rik UTSW 17 56877431 missense probably benign
R1779:1700061G19Rik UTSW 17 56885169 nonsense probably null
R2008:1700061G19Rik UTSW 17 56886478 missense probably benign 0.04
R2102:1700061G19Rik UTSW 17 56884949 nonsense probably null
R2247:1700061G19Rik UTSW 17 56877435 missense possibly damaging 0.83
R2484:1700061G19Rik UTSW 17 56882641 missense probably benign 0.00
R2917:1700061G19Rik UTSW 17 56885141 missense probably damaging 1.00
R3773:1700061G19Rik UTSW 17 56876262 start codon destroyed probably null 0.00
R4829:1700061G19Rik UTSW 17 56883500 splice site probably null
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4860:1700061G19Rik UTSW 17 56888655 missense probably benign 0.09
R4887:1700061G19Rik UTSW 17 56876324 missense possibly damaging 0.84
R5043:1700061G19Rik UTSW 17 56885198 missense probably damaging 1.00
R5112:1700061G19Rik UTSW 17 56877465 missense probably benign 0.03
R5161:1700061G19Rik UTSW 17 56882888 missense possibly damaging 0.84
R5214:1700061G19Rik UTSW 17 56886493 missense probably benign
R5287:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5403:1700061G19Rik UTSW 17 56876221 unclassified probably benign
R5779:1700061G19Rik UTSW 17 56881061 missense probably benign 0.02
R5997:1700061G19Rik UTSW 17 56876373 missense probably benign 0.02
R6198:1700061G19Rik UTSW 17 56882679 missense probably damaging 1.00
R6259:1700061G19Rik UTSW 17 56877513 missense probably benign 0.04
R6357:1700061G19Rik UTSW 17 56877591 critical splice donor site probably null
R6754:1700061G19Rik UTSW 17 56883358 missense probably damaging 0.99
R6842:1700061G19Rik UTSW 17 56877432 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGAGGAAGCAGACACCCC -3'
(R):5'- GCCATAGGTATCACCCTTACTC -3'

Sequencing Primer
(F):5'- CACTGTGGACACCTGGTC -3'
(R):5'- AGGACTTCAACGGCCACTG -3'
Posted On2015-02-05