Incidental Mutation 'R3151:P2rx7'
ID264396
Institutional Source Beutler Lab
Gene Symbol P2rx7
Ensembl Gene ENSMUSG00000029468
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 7
SynonymsP2X7R, P2X7 receptor, P2X(7)
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122643911-122691432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122681266 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 584 (T584A)
Ref Sequence ENSEMBL: ENSMUSP00000098303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]
Predicted Effect probably benign
Transcript: ENSMUST00000031425
SMART Domains Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 1e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100737
AA Change: T584A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: T584A

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 397 3.6e-158 PFAM
low complexity region 435 451 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121489
SMART Domains Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 3.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199371
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in P2rx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:P2rx7 APN 5 122676698 missense probably damaging 1.00
IGL01911:P2rx7 APN 5 122658768 missense probably damaging 0.99
IGL02375:P2rx7 APN 5 122673656 splice site probably benign
IGL02502:P2rx7 APN 5 122680987 missense possibly damaging 0.92
IGL03102:P2rx7 APN 5 122663605 missense possibly damaging 0.88
IGL03179:P2rx7 APN 5 122673700 missense possibly damaging 0.66
ailing UTSW 5 122673736 missense probably benign
Enfermo UTSW 5 122652789 missense probably damaging 0.98
incapacitated UTSW 5 122673793 missense probably damaging 0.99
sickpuppy UTSW 5 122681003 missense probably damaging 0.96
PIT1430001:P2rx7 UTSW 5 122681216 missense probably damaging 0.99
R0363:P2rx7 UTSW 5 122657030 nonsense probably null
R0558:P2rx7 UTSW 5 122673798 missense possibly damaging 0.83
R1186:P2rx7 UTSW 5 122670451 missense probably damaging 1.00
R1709:P2rx7 UTSW 5 122670465 missense possibly damaging 0.95
R1856:P2rx7 UTSW 5 122681032 missense probably damaging 1.00
R1899:P2rx7 UTSW 5 122673736 missense probably benign
R1905:P2rx7 UTSW 5 122680952 missense probably damaging 1.00
R2082:P2rx7 UTSW 5 122644095 missense possibly damaging 0.92
R2117:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R2205:P2rx7 UTSW 5 122681101 missense probably damaging 1.00
R2446:P2rx7 UTSW 5 122680816 missense probably benign
R4052:P2rx7 UTSW 5 122666277 missense probably damaging 1.00
R4883:P2rx7 UTSW 5 122681066 missense probably damaging 1.00
R4930:P2rx7 UTSW 5 122670479 missense probably damaging 1.00
R5194:P2rx7 UTSW 5 122673795 missense probably benign 0.00
R5257:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5258:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5481:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R5656:P2rx7 UTSW 5 122673717 missense probably damaging 0.99
R5738:P2rx7 UTSW 5 122652789 missense probably damaging 0.98
R6587:P2rx7 UTSW 5 122664550 missense probably damaging 1.00
R7098:P2rx7 UTSW 5 122673793 missense probably damaging 0.99
R7120:P2rx7 UTSW 5 122681294 missense probably benign
R7180:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R7358:P2rx7 UTSW 5 122666142 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGCTCTTCCATAAGCTCGTG -3'
(R):5'- CTCGCCATTGGTCTAATCAGC -3'

Sequencing Primer
(F):5'- TCGTGCTGTCCCGAGAC -3'
(R):5'- AATCAGCTCTCTTCTTCAACACAG -3'
Posted On2015-02-05